SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[SW|RNA polymerase] ECF-type [SW|sigma factor] SigX, required for resistance against cationic antimicrobial peptides
23.03 kDa
protein length
194 aa Sequence Blast
gene length
585 bp Sequence Blast
resistance to cationic antimcrobial peptides
[SW|RNA polymerase] ECF-type [SW|sigma factor] SigX

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,414,627 → 2,415,211

    The protein

    Protein family

  • [SW|Sigma-70 factor family] (according to UniProt)
  • [SW|ECF subfamily] (according to UniProt)
  • Structure

  • [PDB|6DXO] (from Streptomyces venezuelae, 28% identity) [pubmed|29905823]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Additional information

  • Expression of the [SW|SigX regulon] in increased in ''[gene|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|ugtP]'' mutants [Pubmed|22362028]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9636707], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|9636707], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulatory mechanism

  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: activation, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • regulation

  • induced by glucose [Pubmed|27965645], this depends on [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials


  • MGNA-A179 (sigX::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A901 ( ''sigX''::''spec''), [Pubmed| ], available at [ BGSC]
  • BKE23100 (Δ[gene|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAAACCCCTCCGTTC, downstream forward: _UP4_GAGCTTTTGAGGGAGGAGCT
  • BKK23100 (Δ[gene|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAAACCCCTCCGTTC, downstream forward: _UP4_GAGCTTTTGAGGGAGGAGCT
  • References


  • 24921931,26901131
  • The [SW|SigX regulon]

  • 9683469,17675383,10960106
  • Other original publications

  • 11222589,9139908,14993308,12399481,14762009,19047346,14651641,19465659,9636707,16306698,7934830,19767430,9393439,22362028,23103977,20817771,26364265,27137497,27965645,30355672,29905823,31118925