SubtiBank SubtiBank
fecF
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

fecF

iron/citrate ABC transporter (ATP-binding protein)
locus
BSU_07490
pI
6.07
mw
29.31 kDa
protein length
266 aa Sequence Blast
gene length
801 bp Sequence Blast
function
iron uptake
product
iron/citrate ABC transporter (ATP-binding protein)
essential
no
ec
3.6.3.-
synonyms
yfmF

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.5|Uptake of iron/ siderophores]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.1|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.4|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    822,903 → 823,703

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|E70BE74D5AB4B06CDFF902E58A0B9EBF477E21EC|FhuC], [protein|473628F86C18FE9957841F3C8B45242C90CB341D|FpbP], [protein|5C52DB31F378E49AABE5D937DD901A68F3810477|YusV]
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 4-240) (according to UniProt)
  • Structure

  • [PDB|4G1U] (from ''Yersinia pestis'', the [protein|BDAA56484E05DA3C1CB0CA09873A365657999679|FecD]-[protein|800EAB1D8617589CCAC68FB874EFCDE4C77962E1|FecE]-[protein|E76640F895261DA34AD2342B54B43D11857AEA9A|FecF] complex, 32% identity) [Pubmed|23142986]
  • [SW|Localization]

  • associated to the membrane (via [protein|BDAA56484E05DA3C1CB0CA09873A365657999679|FecD]-[protein|800EAB1D8617589CCAC68FB874EFCDE4C77962E1|FecE]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|569510093E5B69A0368205920A21A81CADF030E9|fecC]-[gene|BDAA56484E05DA3C1CB0CA09873A365657999679|fecD]-[gene|800EAB1D8617589CCAC68FB874EFCDE4C77962E1|fecE]-[gene|E76640F895261DA34AD2342B54B43D11857AEA9A|fecF]
    description
    [Pubmed|16672620]

    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [Pubmed|16672620,12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • immediately induced upon iron starvation (first wave to allow iron uptake) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [Pubmed|29133393,16672620,12354229]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C244 (yfmF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2242 NBRP B. subtilis, Japan]
  • BKE07490 (Δ[gene|E76640F895261DA34AD2342B54B43D11857AEA9A|fecF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGTTTTCCCATGGTATCCT, downstream forward: _UP4_TGAAAAGGAGAGGAATTCCC
  • BKK07490 (Δ[gene|E76640F895261DA34AD2342B54B43D11857AEA9A|fecF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGTTTTCCCATGGTATCCT, downstream forward: _UP4_TGAAAAGGAGAGGAATTCCC
  • References

  • 10092453,16672620,23142986,29133393