SubtiBank SubtiBank
ydzF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydzF

[SW|MarR family|MarR/DUF24 family] transcription regulator
locus
BSU_05270
pI
9.33
mw
12.44 kDa
protein length
109 aa Sequence Blast
gene length
330 bp Sequence Blast
function
unknown
product
[SW|MarR family|MarR/DUF24 family] transcription regulator
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    574,106 → 574,435

    The protein

    Protein family

  • [SW|MarR family|MarR/DUF24 family]
  • Paralogous protein(s)

  • [protein|51B1913B59C1876CCED4A88414797B3A22BE4E3C|YdeP], [protein|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB], [protein|91085DA5E71B88E533D2E1D1BFB53E908116C6AA|HypR], [protein|C57DDC9710CB557179B062F9C5D786DB02A3B5FC|YkvN], [protein|D9A187961CFB9496A6712E9E48AAD384357A3E1C|HxlR], [protein|1E74F0557FF9ECB404B6544831F4E0A162473423|YtcD]
  • [SW|Domains]

  • [SW|HTH hxlR-type domain] (aa 10-109) (according to UniProt)
  • Structure

  • [PDB|4A5M] ([protein|91085DA5E71B88E533D2E1D1BFB53E908116C6AA|HypR], 45% identity) [pubmed|22238377]
  • Expression and Regulation

    Operons

    genes
    [gene|E757C4B329A99E3D0C70C77437DF4DDA300CA5E7|ydzF]-[gene|3874C566F1C71F985C86726458B8544F115A6396|ydeN]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C166 (ydzF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2164 NBRP B. subtilis, Japan]
  • BKE05270 (Δ[gene|E757C4B329A99E3D0C70C77437DF4DDA300CA5E7|ydzF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTAATCAAACCTCCTT, downstream forward: _UP4_TAAAGCTACTTACAAAAAAG
  • BKK05270 (Δ[gene|E757C4B329A99E3D0C70C77437DF4DDA300CA5E7|ydzF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTAATCAAACCTCCTT, downstream forward: _UP4_TAAAGCTACTTACAAAAAAG
  • References

    Research papers

  • 22238377