SubtiBank SubtiBank
lutR
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

lutR

transcriptional repressor (GntR family) of the lutA-lutB-lutC operon and of lutP
locus
BSU34180
pI
4.84
mw
19.50 kDa
protein length
175 aa Sequence Blast
gene length
525 bp Sequence Blast
function
control of lactate utilization
product
transcriptional repressor, (GntR family)
essential
no
synonyms
yvfI

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    3,509,831 → 3,510,490

    The protein

    Catalyzed reaction/ biological activity

  • transcriptional repressor of the'' [gene|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|lutA]-[gene|57B9E37F6232189CD47C1B41FDCF43FCB8016AEB|lutB]-[gene|5EE69198882DF4E9AB8D9D7267F071EF88C2F16D|lutC]'' operon [Pubmed|19201793]
  • Protein family

  • [SW|GntR family] of transcription factors
  • Effectors of protein activity

  • lactate acts as molecular inducer [Pubmed|19201793]
  • Expression and Regulation

    Operons

    genes
    [gene|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|25031425], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B607 (yvfI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1606 NBRP B. subtilis, Japan]
  • TEK1 lutR::Tn10::spc [Pubmed|24196425]
  • BKE34180 (Δ[gene|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTAATAGGGCATCCG, downstream forward: _UP4_TAACCAACTCATTTCCCGGG
  • BKK34180 (Δ[gene|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTAATAGGGCATCCG, downstream forward: _UP4_TAACCAACTCATTTCCCGGG
  • Expression vector

  • pQE60-lutR (His-tag) [Pubmed|24196425]
  • lacZ fusion

  • TEK7 lutR::lacZ::erm [Pubmed|24196425]
  • Labs working on this gene/protein

  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
  • [SW|Ayten Katatas], Istanbul Technical University, Istanbul, Turkey [http://www.bio.itu.edu.tr/personel_data/personel_ayten_yazgan_karatas.htm x]
  • References

  • 24196425,19201793,25031425,18604637