SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


acetolactate synthase (large subunit)
62.42 kDa
protein length
574 aa Sequence Blast
gene length
1725 bp Sequence Blast
biosynthesis of branched-chain amino acids
acetolactate synthase (large subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of branched-chain amino acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    2,895,248 → 2,896,972

    The protein

    Catalyzed reaction/ biological activity

  • 2 pyruvate = 2-acetolactate CO2 (according to Swiss-Prot)
  • Protein family

  • [SW|TPP enzyme family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|YdaP], [protein|AAA45830B9C5428CADFA5551D33B513E9B1B7C8E|AlsS]
  • Modification

  • phosphorylated on Arg-297 [Pubmed|22517742]
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|4RJJ] [Pubmed|25393087]
  • [PDB|1N53] (T box RNA)
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1577690], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|T-box|T-box]: termination/antitermination, via tRNA controlled [SW|RNA switch], repression by BCAA, in [regulon|T-box|T-box]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|15547269], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [pubmed|12618455] [pubmed|18083814], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: activation, [Pubmed|12193635], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expression is stimulated in the presence of glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [PubMed|12193635]
  • additional information

  • An [SW|ncRNA|antisense RNA] is predicted for [gene|1502AED337F59DFFCEAFF68FE111C5AA6155701B|leuA] [PubMed|20525796]
  • the [SW|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • GP324, ''ilvB'' under control of pXyl (cat), available in [SW|Jörg Stülke]'s lab
  • BKE28310 (Δ[gene|E6EDDB6D1EDA85D73A0B78A656511D38346A625B|ilvB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTAGTTCCTCCTTTTG, downstream forward: _UP4_CATGAAATGGTGGGGGTGAA
  • BKK28310 (Δ[gene|E6EDDB6D1EDA85D73A0B78A656511D38346A625B|ilvB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTAGTTCCTCCTTTTG, downstream forward: _UP4_CATGAAATGGTGGGGGTGAA
  • lacZ fusion

  • pGP520 and pGP524 (both in [SW|pAC5]), pGP523 (in [SW|pAC6]), all are available in [SW|Jörg Stülke]'s lab
  • References

  • 21303765,15060025,19258532,8289305,17488331,18083814,18641142,24163341,15547269,12618455,12107147,1577690,12193635,15916605,15916606,20935095,22517742,22900538,25157083,25755103,26220295,28516784,29794222,25393087