SubtiBank SubtiBank
recQ [2017-11-02 14:18:02]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

recQ [2017-11-02 14:18:02]

ATP-dependent DNA helicase, acts together with YrvE
locus
BSU19220
pI
5.92
mw
67.18 kDa
protein length
591 aa Sequence Blast
gene length
1773 bp Sequence Blast
function
DNA repair
product
ATP-dependent DNA helicase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    Coordinates
    2,094,010 → 2,095,785

    The protein

    Paralogous protein(s)

  • [protein|4A4FCD876C3CA1D821792803CA2A0CB2E97D3F5E|RecS]
  • Expression and Regulation

    Operons

    genes
    [gene|E85341621B3835F63F07C506E08B73A92E588B1F|bsrA]-[gene|E6EA8098E37A4A2F7370920AC1A500EE4319AAA2|recQ]-[gene|BEBA71A2EF56DAEAF80924856DA68124805BB158|yocH]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B414 (yocI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1413 NBRP B. subtilis, Japan]
  • BKE19220 (Δ[gene|E6EA8098E37A4A2F7370920AC1A500EE4319AAA2|recQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGTGTAAACCTCGCT, downstream forward: _UP4_TAAAAAAACAGAAAAACAAT
  • BKK19220 (Δ[gene|E6EA8098E37A4A2F7370920AC1A500EE4319AAA2|recQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGTGTAAACCTCGCT, downstream forward: _UP4_TAAAAAAACAGAAAAACAAT
  • References

    Reviews

  • 22933559
  • Original publications

  • 25246477