SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


ATP-dependent DNA helicase, acts together with [protein|BA755FA1CB1E0C006E9A23489A7C8997141AA498|RecJ] in replication fork maintenance
67.18 kDa
protein length
591 aa Sequence Blast
gene length
1776 bp Sequence Blast
replication fork maintenance
ATP-dependent DNA helicase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.1|DNA replication]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    2,094,010 → 2,095,785

    The protein

    Catalyzed reaction/ biological activity

  • unwinds covalently closed ds DNA (in complex with [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|SSB]) [pubmed|10360177]
  • [protein|search|RecQ ]controls [protein|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|Topo III] (de)catenation activity [pubmed|11497238,10360177]
  • ATP + H2O --> ADP + H+ + phosphate (according to UniProt)
  • Protein family

  • [SW|helicase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|4A4FCD876C3CA1D821792803CA2A0CB2E97D3F5E|RecS]
  • [SW|Domains]

  • [SW|Helicase ATP-binding domain] (aa 27-196) (according to UniProt)
  • [SW|Helicase C-terminal domain] (aa 216-367) (according to UniProt)
  • HRDC domain (aa 513-591) (according to UniProt)
  • Structure

  • [PDB|4Q47] ([protein|E6EA8098E37A4A2F7370920AC1A500EE4319AAA2|RecQ] from Deinococcus radiodurans, 40% identity) [pubmed|25243132]
  • [SW|Localization]

  • associated with the [SW|replisome] [pubmed|17853894]
  • Expression and Regulation


    view in new tab

    Biological materials


  • GP3543 (Δ[gene|E6EA8098E37A4A2F7370920AC1A500EE4319AAA2|recQ]::kan), available in [SW|Jörg Stülke]'s lab
  • MGNA-B414 (yocI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE19220 (Δ[gene|E6EA8098E37A4A2F7370920AC1A500EE4319AAA2|recQ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGTGTAAACCTCGCT, downstream forward: _UP4_TAAAAAAACAGAAAAACAAT
  • BKK19220 (Δ[gene|E6EA8098E37A4A2F7370920AC1A500EE4319AAA2|recQ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGTGTAAACCTCGCT, downstream forward: _UP4_TAAAAAAACAGAAAAACAAT
  • References


  • 11497238,22933559,15217989,32286623
  • Original publications

  • 25246477,25243132,31675066,17853894