SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


maltose-specific permease of the [SW|phosphotransferase systems|phosphotransferase system], EIICB of the [category|SW 1.2.2|PTS]
57.89 kDa
protein length
527 aa Sequence Blast
gene length
1584 bp Sequence Blast
maltose uptake and phosphorylation
maltose-specific [category|SW 1.2.2|PTS], EIICB

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of maltose]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    892,215 → 893,798

    Phenotypes of a mutant

  • no growth on maltose as single carbon source [Pubmed|10627040]
  • The protein

    Catalyzed reaction/ biological activity

  • Protein EIIB N(pi)-phospho-L-histidine/cysteine + sugar = protein EIIB + sugar phosphate (according to Swiss-Prot)
  • Protein family

  • [category|SW 1.2.2|PTS] permease, glucose family [Pubmed|10627040]
  • Structure

  • [PDB|6BVG] (EIIC domain from B. cereus, corresponds to aa 6 - 419, 27% identity) [pubmed|29784777]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11489864], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|AD72489DA260F07B97A213F1F0FBA7CED9471817|GlvR]: activation, [Pubmed|11489864], in [regulon|AD72489DA260F07B97A213F1F0FBA7CED9471817|GlvR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|11489864], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induction by maltose ([protein|search|GlvR]) [Pubmed|11489864]
  • view in new tab

    Biological materials


  • MGNA-C291 (glvC::erm), available at the [ NBRP B. subtilis, Japan]
  • GP110 (spc), available in [SW|Stülke] lab
  • BKE08200 (Δ[gene|E6C7733A12AF9A5322EED444E4A4FF1605A8B20F|malP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGCATCATACCAGAACCCC, downstream forward: _UP4_TAAAGACTGCCCTCCTTTTC
  • BKK08200 (Δ[gene|E6C7733A12AF9A5322EED444E4A4FF1605A8B20F|malP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGCATCATACCAGAACCCC, downstream forward: _UP4_TAAAGACTGCCCTCCTTTTC
  • References

  • 16707683,10627040,11489864,30038046,29784777