SubtiBank SubtiBank
ydzN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydzN

unknown
locus
BSU_05109
pI
9.75
mw
7.00 kDa
protein length
gene length
186 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    557,873 → 558,058

    Expression and Regulation

    Operons

    genes
    [gene|E6BD1DCC68E08DC8D6E684576A6638872A9FE432|ydzN]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE05109 (Δ[gene|E6BD1DCC68E08DC8D6E684576A6638872A9FE432|ydzN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05109 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTAAAAACTCCTTTTTA, downstream forward: _UP4_TAAAAGTCATAAAGTTGGGA
  • BKK05109 (Δ[gene|E6BD1DCC68E08DC8D6E684576A6638872A9FE432|ydzN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05109 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTAAAAACTCCTTTTTA, downstream forward: _UP4_TAAAAGTCATAAAGTTGGGA