SubtiBank SubtiBank
ypuC/2
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypuC/2

part of the ypuC pseudogene
locus
BSU_23330
pI
0.00
mw
0.00 kDa
protein length
gene length
288 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    2,433,878 → 2,434,165

    Expression and Regulation

    Operons

    genes
    [gene|BD57DC17917E229BD315C56A6726C8235E77311B|ypuB]-[gene|8C3F29CD95F72D29A00240C305689117D94876E9|ypuC/1]-[gene|E635BA05792D1FEEC9710F197F7231E5CAC71737|ypuC/2]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10482513], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A091 (ypuC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/91 NBRP B. subtilis, Japan]
  • BKE23330 (Δ[gene|E635BA05792D1FEEC9710F197F7231E5CAC71737|ypuC/2]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCTGAATTGCAGCTGGGC, downstream forward: _UP4_CCGAGCGAACAGACTTTAAC
  • BKK23330 (Δ[gene|E635BA05792D1FEEC9710F197F7231E5CAC71737|ypuC/2]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCTGAATTGCAGCTGGGC, downstream forward: _UP4_CCGAGCGAACAGACTTTAAC
  • References

  • 10482513