SubtiBank SubtiBank
tatCY
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

tatCY

component of the [protein|780FDF3DD260287428B397FFE7F44DDF1917381C|TatAY]-[protein|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|TatCY] twin-arginine translocase
locus
BSU_05990
pI
9.69
mw
28.91 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast
function
TAT [SW|protein secretion]
product
component of the twin-arginine translocation pathway
essential
no
synonyms
ydiJ

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    647,940 → 648,704

    The protein

    Catalyzed reaction/ biological activity

  • secretion of [protein|3985F88334D7B034A66473C5BB39188AB61A65F6|EfeB] and [protein|253A24EEA02C07E577A96FB64DF39F9A3D0C3A52|YkuE]
  • delivers [protein|D4AF96C936093BA44E46FF92A3EDE437495B0923|QcrA] to the membrane [Pubmed|23256564]
  • Protein family

  • tatC family (with [protein|A58C9B9BB6574662A44AF0C7A94DFFE368B740E2|TatCD], according to UniProt)
  • Paralogous protein(s)

  • [protein|A58C9B9BB6574662A44AF0C7A94DFFE368B740E2|TatCD]
  • Structure

  • [PDB|4HTT] (from Aquifex aeolicus, 35% identity) [pubmed|23583035]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot), Polar (Septum) [Pubmed|16479537]
  • Additional information

  • [protein|780FDF3DD260287428B397FFE7F44DDF1917381C|TatAY]-[protein|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|TatCY]-dependent export of [protein|253A24EEA02C07E577A96FB64DF39F9A3D0C3A52|YkuE] and [protein|3985F88334D7B034A66473C5BB39188AB61A65F6|EfeB] requires a functional [protein|DC0FDCA3FA6742B023E6877CE9554AA1D47012BB|WprA] [Pubmed|23180473]
  • Expression and Regulation

    Operons

    genes
    [gene|780FDF3DD260287428B397FFE7F44DDF1917381C|tatAY]-[gene|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|tatCY]
    description
    [Pubmed|22383849]

    regulation

  • constitutitvely expressed [Pubmed|22383849]
  • view in new tab

    genes
    [gene|4A8D74B83E20FA138ED66F0D8FD456B69B740D92|ydiG]-[gene|B5EF521437323EF43F08E5EFDB5C798616CA499A|rex]-[gene|780FDF3DD260287428B397FFE7F44DDF1917381C|tatAY]-[gene|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|tatCY]
    description
    [Pubmed|22383849]

    regulation

  • constitutitvely expressed [Pubmed|22383849]
  • the mRNA is processed between [gene|B5EF521437323EF43F08E5EFDB5C798616CA499A|rex] and [gene|780FDF3DD260287428B397FFE7F44DDF1917381C|tatAY] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE05990 (Δ[gene|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|tatCY]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTAACTTACTGATCTT, downstream forward: _UP4_TAATAAAAAATCCATTTCTC
  • BKK05990 (Δ[gene|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|tatCY]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTAACTTACTGATCTT, downstream forward: _UP4_TAATAAAAAATCCATTTCTC
  • labs

  • [SW|Jan Maarten van Dijl], University of Groningen, The Netherlands, [https://www.rug.nl/staff/j.m.van.dijl/ Homepage]
  • References

    Reviews

  • 22683878,24140208,25975269,25494301,27121927,31401776
  • Research papers

  • 23583035
  • Original publications

  • 11007775,15554971,22041895,16479537,19383693,19395490,21479178,22544248,22767609,22383849,23256564,24236045,24875903,23180473,26239117,32302670