SubtiBank SubtiBank
yisP
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yisP

farnesyl diphosphate phosphatase, production of farnesol
locus
BSU_10810
pI
7.26
mw
31.35 kDa
protein length
274 aa Sequence Blast
gene length
825 bp Sequence Blast
function
control of KinC activity
product
farnesyl diphosphate phosphatase
essential
no
synonyms
yucD

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.3|Biosynthesis of isoprenoids]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay]
  • Gene

    Coordinates
    1,159,922 → 1,160,746

    Phenotypes of a mutant

  • complete loss of pellicle-forming ability [Pubmed|20713508]
  • reduced [SW|protein secretion] [Pubmed|23651456]
  • The protein

    Catalyzed reaction/ biological activity

  • farnesyl diphosphate -→ farnesol [Pubmed|25308276]
  • Protein family

  • phytoene/squalene synthase family (single member, according to UniProt)
  • [SW|Cofactors]

  • NADH [Pubmed|20713508]
  • Structure

  • [PDB|3WE9] [Pubmed|25308276]
  • Expression and Regulation

    Operons

    genes
    [gene|E5F32D960F6FF50A7B0E4B268D2296FE1A291512|yisP]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B190 (yisP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1189 NBRP B. subtilis, Japan]
  • BKE10810 (Δ[gene|E5F32D960F6FF50A7B0E4B268D2296FE1A291512|yisP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGCTTCTTCAAGTCTAG, downstream forward: _UP4_TAAAAAACACCCGGCCTTGA
  • BKK10810 (Δ[gene|E5F32D960F6FF50A7B0E4B268D2296FE1A291512|yisP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGCTTCTTCAAGTCTAG, downstream forward: _UP4_TAAAAAACACCCGGCCTTGA
  • References

    Reviews

  • 25457121,25652542
  • Original publications

  • 20713508,19935659,23651456,23295493,25308276,26577401