SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


farnesyl diphosphate phosphatase, production of farnesol
31.35 kDa
protein length
274 aa Sequence Blast
gene length
825 bp Sequence Blast
control of [protein|A656321846B2E0D1F39B528E2D8B8E620CCD1148|KinC] activity
farnesyl diphosphate phosphatase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW|Biosynthesis of isoprenoids]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay]
  • Gene

    1,159,922 → 1,160,746

    Phenotypes of a mutant

  • complete loss of pellicle-forming ability [Pubmed|20713508]
  • reduced [SW|protein secretion] [Pubmed|23651456]
  • The protein

    Catalyzed reaction/ biological activity

  • farnesyl diphosphate -→ farnesol [Pubmed|25308276]
  • Protein family

  • phytoene/squalene synthase family (single member, according to UniProt)
  • [SW|Cofactors]

  • NADH [Pubmed|20713508]
  • Structure

  • [PDB|3WE9] [Pubmed|25308276]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials


  • MGNA-B190 (yisP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE10810 (Δ[gene|E5F32D960F6FF50A7B0E4B268D2296FE1A291512|yisP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGCTTCTTCAAGTCTAG, downstream forward: _UP4_TAAAAAACACCCGGCCTTGA
  • BKK10810 (Δ[gene|E5F32D960F6FF50A7B0E4B268D2296FE1A291512|yisP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGCTTCTTCAAGTCTAG, downstream forward: _UP4_TAAAAAACACCCGGCCTTGA
  • References


  • 25457121,25652542
  • Original publications

  • 20713508,19935659,23651456,23295493,25308276,26577401