SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


inhibitor of [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|KinA] autophosphorylation, and subsequently of entry into [SW|sporulation]
16.55 kDa
protein length
154 aa Sequence Blast
gene length
465 bp Sequence Blast
control of entry into [SW|sporulation] via the [SW|phosphorelay]
inhibitor of [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|KinA] autophosphorylation

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW|Proteins controlling the activity of the kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW|Proteins controlling the activity of the kinases]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    3,882,191 → 3,882,655

    Phenotypes of a mutant

  • the'' [gene|E5E2994D96FCECEE75E15136A08308C7B6C1C183|sivA] [gene|E06A3392E644FEDC6F46ED41BBE89168F59B76B3|bslA]'' double mutant exhibits a more severe loss of repellency of the biofilm surface as compared to the ''[gene|E06A3392E644FEDC6F46ED41BBE89168F59B76B3|bslA]'' mutant [Pubmed|22571672]
  • The protein

    Catalyzed reaction/ biological activity

  • inhibits [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|KinA] autophophorylation [Pubmed|23335417]
  • Protein family

  • BslA/BslB family (with [protein|E06A3392E644FEDC6F46ED41BBE89168F59B76B3|BslA], according to UniProt)
  • Paralogous protein(s)

  • [protein|E06A3392E644FEDC6F46ED41BBE89168F59B76B3|BslA]
  • Structure

  • [PDB|5MKD]
  • [SW|Localization]

  • membrane (according to Swiss-Prot)
  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials


  • MGNA-B238 (yweA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37800 (Δ[gene|E5E2994D96FCECEE75E15136A08308C7B6C1C183|sivA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACATTTCCCCCTAATT, downstream forward: _UP4_TAATCGATAGATTTGTAGTC
  • BKK37800 (Δ[gene|E5E2994D96FCECEE75E15136A08308C7B6C1C183|sivA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACATTTCCCCCTAATT, downstream forward: _UP4_TAATCGATAGATTTGTAGTC
  • References

  • 18957862,12823818,22571672,23335417,20817675,28698374,28751732