SubtiBank SubtiBank
nap
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

nap

carboxylesterase NA
locus
BSU_05440
pI
5.80
mw
33.80 kDa
protein length
300 aa Sequence Blast
gene length
903 bp Sequence Blast
function
lipid degradation
product
carboxylesterase NA
essential
no
ec
3.1.1.1
synonyms
cesA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.4|Utilization of lipids/ other]
  • Gene

    Coordinates
    592,303 → 593,205

    The protein

    Catalyzed reaction/ biological activity

  • carboxylic ester + H2O --> alcohol + carboxylate (according to UniProt)
  • Protein family

  • [SW|AB hydrolase superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|27FB777AEBCC794A5A768C7FE7D8374BCEA75913|YbfK]
  • [SW|Domains]

  • [SW|AB hydrolase-1 domain] (aa 58-286) (according to InterPro)
  • Structure

  • [PDB|2R11]
  • Expression and Regulation

    Operons

    genes
    [gene|E5A59EE56092F8042128B19D5E8DEFAE41C78000|nap]
    description
    [Pubmed|12823818]
    view in new tab

    Biological materials

    Mutant

  • BKE05440 (Δ[gene|E5A59EE56092F8042128B19D5E8DEFAE41C78000|nap]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAATGCCCCTCCCAA, downstream forward: _UP4_TAAGGGCTTATAAGATAGTG
  • BKK05440 (Δ[gene|E5A59EE56092F8042128B19D5E8DEFAE41C78000|nap]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAATGCCCCTCCCAA, downstream forward: _UP4_TAAGGGCTTATAAGATAGTG
  • References

  • 12823818,24418394,22248594