SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


carboxylesterase NA
33.80 kDa
protein length
300 aa Sequence Blast
gene length
903 bp Sequence Blast
lipid degradation
carboxylesterase NA

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW|Utilization of lipids/ other]
  • Gene

    592,303 → 593,205

    The protein

    Catalyzed reaction/ biological activity

  • A carboxylic ester + H2O = an alcohol + a carboxylate (according to Swiss-Prot)
  • Protein family

  • [SW|AB hydrolase superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|27FB777AEBCC794A5A768C7FE7D8374BCEA75913|YbfK]
  • Structure

  • [PDB|2R11]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE05440 (Δ[gene|E5A59EE56092F8042128B19D5E8DEFAE41C78000|nap]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAATGCCCCTCCCAA, downstream forward: _UP4_TAAGGGCTTATAAGATAGTG
  • BKK05440 (Δ[gene|E5A59EE56092F8042128B19D5E8DEFAE41C78000|nap]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAATGCCCCTCCCAA, downstream forward: _UP4_TAAGGGCTTATAAGATAGTG
  • References

  • 12823818,24418394,22248594