SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


spore coat protein
18.58 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast
resistance of the spore
spore coat protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Not yet assigned]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    4,167,110 → 4,167,592

    The protein

    Protein family

  • [SW|CotF family] (according to UniProt)
  • Modification

  • phosphorylated on Arg-155 [pubmed|31221751]
  • [SW|Localization]

  • inner spore coat [Pubmed|19933362]
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [SW|SpoIIID]) [Pubmed|15699190,15383836]
  • view in new tab

    Biological materials


  • 1S106 ( ''cotF''::''cat''), [Pubmed|1708381], available at [ BGSC]
  • 1S107 ( ''cotF''::''cat''), [Pubmed|1708381], available at [ BGSC]
  • BKE40530 (Δ[gene|E585AF0E27A5EA44974D119CE716194B645CA15B|cotF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGAAAATTCTCCTTTA, downstream forward: _UP4_TAAAACAAGCAGCAAAGGAG
  • BKK40530 (Δ[gene|E585AF0E27A5EA44974D119CE716194B645CA15B|cotF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGAAAATTCTCCTTTA, downstream forward: _UP4_TAAAACAAGCAGCAAAGGAG
  • References

  • 1708381,19933362,15699190,15383836,31221751