SubtiBank SubtiBank
cotF

cotF

spore coat protein
locus
BSU_40530
pI
7.37
mw
18.58 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast
function
resistance of the spore
product
spore coat protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    4,167,110 → 4,167,592

    The protein

    Protein family

  • [SW|CotF family] (according to UniProt)
  • Modification

  • phosphorylated on Arg-155 [pubmed|31221751]
  • [SW|Localization]

  • inner spore coat [Pubmed|19933362]
  • Expression and Regulation

    Operons

    genes
    [gene|E585AF0E27A5EA44974D119CE716194B645CA15B|cotF]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [SW|SpoIIID]) [Pubmed|15699190,15383836]
  • view in new tab

    Biological materials

    Mutant

  • 1S106 ( ''cotF''::''cat''), [Pubmed|1708381], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S106&Search=1S106 BGSC]
  • 1S107 ( ''cotF''::''cat''), [Pubmed|1708381], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S107&Search=1S107 BGSC]
  • BKE40530 (Δ[gene|E585AF0E27A5EA44974D119CE716194B645CA15B|cotF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGAAAATTCTCCTTTA, downstream forward: _UP4_TAAAACAAGCAGCAAAGGAG
  • BKK40530 (Δ[gene|E585AF0E27A5EA44974D119CE716194B645CA15B|cotF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGAAAATTCTCCTTTA, downstream forward: _UP4_TAAAACAAGCAGCAAAGGAG
  • References

  • 1708381,19933362,15699190,15383836,31221751