SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


8.40 kDa
protein length
gene length
228 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    713,308 → 713,535

    Biological materials


  • BKE06559 (Δ[gene|E562F0C7A5CB9B9AEA3EFDF15138EC7D3497B89A|yezF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGAAATCCGCTCCTTTT, downstream forward: _UP4_AACGGATAAATGGAAAAGCT
  • BKK06559 (Δ[gene|E562F0C7A5CB9B9AEA3EFDF15138EC7D3497B89A|yezF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGAAATCCGCTCCTTTT, downstream forward: _UP4_AACGGATAAATGGAAAAGCT