SubtiBank SubtiBank
yezF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yezF

unknown
locus
BSU_06559
pI
9.73
mw
8.40 kDa
protein length
gene length
228 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    713,308 → 713,535

    Biological materials

    Mutant

  • BKE06559 (Δ[gene|E562F0C7A5CB9B9AEA3EFDF15138EC7D3497B89A|yezF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06559 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGAAATCCGCTCCTTTT, downstream forward: _UP4_AACGGATAAATGGAAAAGCT
  • BKK06559 (Δ[gene|E562F0C7A5CB9B9AEA3EFDF15138EC7D3497B89A|yezF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06559 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGAAATCCGCTCCTTTT, downstream forward: _UP4_AACGGATAAATGGAAAAGCT