SubtiBank SubtiBank
yqhB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqhB

general stress protein, required for protection against oxidative stress
locus
BSU24750
pI
5.54
mw
49.79 kDa
protein length
442 aa Sequence Blast
gene length
1329 bp Sequence Blast
function
protection against stress conditions
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,561,585 → 2,562,913

    The protein

    Protein family

  • UPF0053 family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|45F03AB13292BBF0554785C7C02FE29033EDD742|YrkA], [protein|A459410312A926365B45CEB4694DE399B38820A2|YugS], [protein|B2E9D026B668C8530C406353E3400059388566FB|YhdT], [protein|BE0777DE7C40825D4DB7252EA84AAB3892578529|YhdP]
  • [SW|Domains]

  • [SW|DUF21 domain] (14-210)
  • 2 [SW|CBS domain]s (229-290, 295-355)
  • Structure

  • [PDB|4HG0] (CorC from E. coli, corresponds to the [SW|CBS domain]s and the C-terminal transporter-associated domain)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|E53B8D437B848B637AEC8C1BB9428EC8B6EB280E|yqhB]
    description
    [Pubmed|16267290]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C474 (yqhB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2472 NBRP B. subtilis, Japan]
  • BKE24750 (Δ[gene|E53B8D437B848B637AEC8C1BB9428EC8B6EB280E|yqhB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCACCTCCCTTTTCCGA, downstream forward: _UP4_TAGCCCGTGAAAGGCTGTTC
  • BKK24750 (Δ[gene|E53B8D437B848B637AEC8C1BB9428EC8B6EB280E|yqhB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCACCTCCCTTTTCCGA, downstream forward: _UP4_TAGCCCGTGAAAGGCTGTTC
  • Expression vectors

  • pGP2935 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References

  • 16267290,15805528,22582280,27933050