SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to magnesium exporter, general stress protein, required for protection against oxidative stress
49.79 kDa
protein length
442 aa Sequence Blast
gene length
1329 bp Sequence Blast
protection against stress conditions

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW|Magnesium uptake/ efflux]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,561,585 → 2,562,913

    The protein

    Protein family

  • [SW|UPF0053 family](according to UniProt)
  • Paralogous protein(s)

  • [protein|45F03AB13292BBF0554785C7C02FE29033EDD742|YrkA], [protein|A459410312A926365B45CEB4694DE399B38820A2|YugS], [protein|B2E9D026B668C8530C406353E3400059388566FB|YhdT], [protein|BE0777DE7C40825D4DB7252EA84AAB3892578529|YhdP]
  • [SW|Domains]

  • [SW|DUF21 domain] (14-210)
  • 2 [SW|CBS domain]s (229-290, 295-355)
  • Structure

  • [PDB|4HG0] (CorC from E. coli, corresponds to the [SW|CBS domain]s and the C-terminal transporter-associated domain)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials


  • MGNA-C474 (yqhB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE24750 (Δ[gene|E53B8D437B848B637AEC8C1BB9428EC8B6EB280E|yqhB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCACCTCCCTTTTCCGA, downstream forward: _UP4_TAGCCCGTGAAAGGCTGTTC
  • BKK24750 (Δ[gene|E53B8D437B848B637AEC8C1BB9428EC8B6EB280E|yqhB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCACCTCCCTTTTCCGA, downstream forward: _UP4_TAGCCCGTGAAAGGCTGTTC
  • Expression vectors

  • pGP2935 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References

  • 16267290,15805528,22582280,27933050,31415562