SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


dihydroorotic acid dehydrogenase (catalytic subunit)
32.94 kDa
protein length
311 aa Sequence Blast
gene length
936 bp Sequence Blast
pyrimidine biosynthesis
dihydroorotic acid dehydrogenase (catalytic subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • Gene

    1,627,718 → 1,628,653

    The protein

    Catalyzed reaction/ biological activity

  • (S)-dihydroorotate + NAD+ --> H+ + NADH + orotate (according to UniProt)
  • Protein family

  • dihydroorotate dehydrogenase family (single member, according to UniProt)
  • [SW|Cofactors]

  • FMN [pubmed|11188687]
  • Structure

  • [PDB|1EP1] (from ''Lactococcus lactis'', 68% identity) [Pubmed|11188687]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1709162], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR]: termination/ antitermination, via [SW|RNA switch], in [regulon|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR regulon]
  • regulation

  • induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
  • view in new tab

    Biological materials


  • 1A806 ( ''pyrD''::''cat''), [Pubmed|15109830], available at [ BGSC]
  • 1A807 ( ''pyrD''::''kan''), [Pubmed|15109830], available at [ BGSC]
  • BKE15540 (Δ[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCCGGCAATTTCACCTCTA, downstream forward: _UP4_GAATGCATCGGAAGGAGCTG
  • BKK15540 (Δ[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCCGGCAATTTCACCTCTA, downstream forward: _UP4_GAATGCATCGGAAGGAGCTG
  • References

  • 8206849,1709162,10545205,11188687