SubtiBank SubtiBank
pyrD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pyrD

dihydroorotic acid dehydrogenase (catalytic subunit)
locus
BSU15540
pI
4.94
mw
32.94 kDa
protein length
311 aa Sequence Blast
gene length
936 bp Sequence Blast
function
pyrimidine biosynthesis
product
dihydroorotic acid dehydrogenase (catalytic subunit)
essential
no
ec
1.3.3.1
synonyms
pyrDI

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.4|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • Gene

    Coordinates
    1,627,718 → 1,628,653

    The protein

    Catalyzed reaction/ biological activity

  • (S)-dihydroorotate + O2 = orotate + H2O2 (according to Swiss-Prot)
  • Protein family

  • Type 1 subfamily (according to Swiss-Prot)
  • [SW|Cofactors]

  • FMN [pubmed|11188687]
  • Structure

  • [PDB|1EP1] (from ''Lactococcus lactis'', 68% identity) [Pubmed|11188687]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]-[gene|A5C26E10085868A0A193C450DF58D54C636B7C2D|pyrP]-[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]-[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]-[gene|E7741ED6F15044900BDC5F0584246469D2D4D586|pyrAA]-[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]-[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]-[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]-[gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]-[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]
    description
    [Pubmed|8206849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1709162], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR]: termination/ antitermination, via [SW|RNA switch], in [regulon|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR regulon]
  • regulation

  • induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
  • view in new tab

    Biological materials

    Mutant

  • 1A806 ( ''pyrD''::''cat''), [Pubmed|15109830], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A806&Search=1A806 BGSC]
  • 1A807 ( ''pyrD''::''kan''), [Pubmed|15109830], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A807&Search=1A807 BGSC]
  • BKE15540 (Δ[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCCGGCAATTTCACCTCTA, downstream forward: _UP4_GAATGCATCGGAAGGAGCTG
  • BKK15540 (Δ[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCCGGCAATTTCACCTCTA, downstream forward: _UP4_GAATGCATCGGAAGGAGCTG
  • References

  • 8206849,1709162,10545205,11188687