SubtiBank SubtiBank
abrB
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

abrB

transcriptional regulator of transition state genes
locus
BSU00370
pI
6.57
mw
10.63 kDa
protein length
gene length
282 bp Sequence Blast
function
regulation of gene expression during the transition from growth to stationary phase
product
transcriptional regulator
essential
no
synonyms
cpsX, tolB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.6|Transition state regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    44,848 → 45,138

    Phenotypes of a mutant

  • No swarming motility on B medium [Pubmed|19202088]
  • The protein

    Paralogous protein(s)

  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh], [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT] (only N-terminal domain)
  • Modification

  • phosphorylated on Ser-86 [Pubmed|20509597] by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC], [protein|E0097A00C82136BB0B1FB89FBA177E28A4EC3D54|PrkD], and [protein|E86A96B832351FF513DD9853EAD8998CC44C9951|YabT] results in loss of DNA-binding activity [Pubmed|24731262]
  • Effectors of protein activity

  • interaction with [protein|899FF5BEE5D3F01778A0175E293EDBBDEB25717D|AbbA] results in inactivation of AbrB [Pubmed|18840696]
  • Structure

  • [PDB|1Z0R] (N-terminal DNA recognition domain), [Pubmed|16223496]
  • [PDB|2MJG] (full-length protein) [Pubmed|25308864]
  • Expression and Regulation

    Operons

    genes
    [gene|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]
    description
    [Pubmed|3145384]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3145384], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, -P [Pubmed|3145384], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|2504584], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed at the onset of stationary phase [Pubmed|3145384]
  • additional information

  • degradation of the ''[SW|abrB]'' mRNA is triggered by base-pairing with [SW|RnaC] [Pubmed|25790031]
  • view in new tab

    Biological materials

    Mutant

  • TT731 (aphA3)
  • 1A935 (''abrB''::''cat''), [Pubmed|11886552], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A935&Search=1A935 BGSC]
  • GP1548 (''abrB''::''ermC''), available in [SW|Stülke] lab
  • BKE00370 (Δ[gene|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCTCCCAAGAGATA, downstream forward: _UP4_TAATCATTTCTTGTACAAAA
  • BKK00370 (Δ[gene|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCTCCCAAGAGATA, downstream forward: _UP4_TAATCATTTCTTGTACAAAA
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Stülke] lab
  • Labs working on this gene/protein

  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
  • [SW|Mark Strauch], Baltimore, USA [http://lifesciences.umaryland.edu/Pages/faculty_profile.aspx?ID=212 homepage]
  • References

    Reviews

  • 11964117,19995980,11931565,19202088,18326573
  • The [SW|AbrB regulon]:

  • 20817675,18840696,23580539
  • Other original publications

  • 19581368,2437099,8878039,11377867,1850083,12586407,2554317,18430133,7768874,2507867,1766371,15687200,1908787,2106683,15687200,2504584,3145384,8821944,8576231,11101897,11395475,11583849,11751836,12123659,12076816,12591885,15610005,16223496,16159768,16702211,17660417,17720793,7592460,19465659,20509597,15101989,19202088,18326573,24534728,24731262,24832089,25002359,25308864,25381239,25790031