SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


phospho-adenylylsulfate sulfotransferase
27.52 kDa
protein length
236 aa Sequence Blast
gene length
711 bp Sequence Blast
sulfate reduction and activation
phospho-adenylylsulfate sulfotransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|sulfur metabolism/ general]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    1,171,755 → 1,172,465

    The protein

    Catalyzed reaction/ biological activity

  • Adenosine 3',5'-bisphosphate + sulfite + thioredoxin disulfide = 3'-phosphoadenylyl sulfate + thioredoxin (according to Swiss-Prot)
  • Protein family

  • CysH subfamily (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|51EB09C122A7166D662AE72842A44EC5FBA03134|CysH]
  • Structure

  • [PDB|2OQ2] (from yeast, 33% identity) [pubmed|18991405]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,15383836]
  • view in new tab

    Biological materials


  • MGNA-A504 (yitB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE10930 (Δ[gene|E5090587E23B284EF3B3D8F3EA5C44CB86EEB82E|yitB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTTTTCCCCCCGTTTG, downstream forward: _UP4_TAGCGGATGGCAGGTTCTTG
  • BKK10930 (Δ[gene|E5090587E23B284EF3B3D8F3EA5C44CB86EEB82E|yitB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTTTTCCCCCCGTTTG, downstream forward: _UP4_TAGCGGATGGCAGGTTCTTG
  • References

  • 15699190,15383836,18991405