SubtiBank SubtiBank
yitB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yitB

phospho-adenylylsulfate sulfotransferase
locus
BSU_10930
pI
5.77
mw
27.52 kDa
protein length
236 aa Sequence Blast
gene length
711 bp Sequence Blast
function
sulfate reduction and activation
product
phospho-adenylylsulfate sulfotransferase
essential
no
ec
1.8.4.8
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.2|sulfur metabolism/ general]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,171,755 → 1,172,465

    The protein

    Catalyzed reaction/ biological activity

  • [thioredoxin]-disulfide + adenosine 3',5'-bisphosphate + 2 H+ + sulfite --> 3'-phosphoadenylyl sulfate + [thioredoxin]-dithiol (according to UniProt)
  • Protein family

  • PAPS reductase family (with [protein|51EB09C122A7166D662AE72842A44EC5FBA03134|CysH], according to UniProt)
  • Paralogous protein(s)

  • [protein|51EB09C122A7166D662AE72842A44EC5FBA03134|CysH]
  • Structure

  • [PDB|2OQ2] (from yeast, 33% identity) [pubmed|18991405]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|E5090587E23B284EF3B3D8F3EA5C44CB86EEB82E|yitB]-[gene|EBBA4432FF83B6F203C694E04111D45290BE157A|yitA]-[gene|FE2B31E5EBE6C4BA4FC4AAC485A00C97315E6AAB|yisZ]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,15383836]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A504 (yitB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/504 NBRP B. subtilis, Japan]
  • BKE10930 (Δ[gene|E5090587E23B284EF3B3D8F3EA5C44CB86EEB82E|yitB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTTTTCCCCCCGTTTG, downstream forward: _UP4_TAGCGGATGGCAGGTTCTTG
  • BKK10930 (Δ[gene|E5090587E23B284EF3B3D8F3EA5C44CB86EEB82E|yitB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTTTTCCCCCCGTTTG, downstream forward: _UP4_TAGCGGATGGCAGGTTCTTG
  • References

  • 15699190,15383836,18991405