SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


unknown, putative binding protein, may control [protein|7EBB09F8FF4C2FBE35B4689B15D89FEF3D58A227|CitS] activity
29.11 kDa
protein length
319 aa Sequence Blast
gene length
960 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    833,228 → 834,187

    The protein

    Catalyzed reaction/ biological activity

  • putative binding protein, may control [protein|7EBB09F8FF4C2FBE35B4689B15D89FEF3D58A227|CitS] activity [Pubmed|14499931]
  • Protein family

  • UPF0065 (bug) family (single member, according to UniProt)
  • Structure

  • [PDB|4X9T] (from Polaromonas sp., 24% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C251 (yflP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07600 (Δ[gene|E4F1B49C26BCB4E3E596406A83CCDCC20AD4A3DB|yflP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAGGATTATAGATTTTTTCA, downstream forward: _UP4_TAAAATCCCGACATCCCGGG
  • BKK07600 (Δ[gene|E4F1B49C26BCB4E3E596406A83CCDCC20AD4A3DB|yflP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAGGATTATAGATTTTTTCA, downstream forward: _UP4_TAAAATCCCGACATCCCGGG
  • References


  • 28152228
  • Original publications

  • 10972810,14499931