SubtiBank SubtiBank
yjzD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjzD

unknown
locus
BSU_11270
pI
8.92
mw
6.85 kDa
protein length
gene length
186 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,204,731 → 1,204,916

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|E4EBA8BC76984F3C98269FBEBE935F77DADB6FF2|yjzD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE11270 (Δ[gene|E4EBA8BC76984F3C98269FBEBE935F77DADB6FF2|yjzD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTTCCACCTCGTCCTT, downstream forward: _UP4_TAAAAAGCCAAAAACCCAAA
  • BKK11270 (Δ[gene|E4EBA8BC76984F3C98269FBEBE935F77DADB6FF2|yjzD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTTCCACCTCGTCCTT, downstream forward: _UP4_TAAAAAGCCAAAAACCCAAA