SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


membrane-bound chemotaxis receptor, methyl-accepting chemotaxis protein, receptor for asparagine, acts also as pH sensor, responds to increasing pH as an attractant signal
71.70 kDa
protein length
662 aa Sequence Blast
gene length
1989 bp Sequence Blast
control of chemotaxis, sensing of alkaline environments
methyl-accepting chemotaxis protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Signal transduction in motility and chemotaxis] → [category|SW|Membrane-bound chemoreceptors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,210,445 → 3,212,433

    The protein

    Paralogous protein(s)

  • [protein|F02E3080214A327E131ECDE0DBC52C57EFDFE2CE|McpA], [protein|4CD44AD8FE68516C84889EAA2137828E06B8A30B|TlpB], [protein|1DE26CDEE952142C1303C822F0E2A63AE09F721B|TlpA]
  • Kinetic information

  • K(D) for asparagine: 14 myM [Pubmed|19864420]
  • [SW|Domains]

  • [SW|Cache domain] (aa 153-229) (according to UniProt)
  • [SW|HAMP domain] (aa 304-356) (according to UniProt)
  • [SW|Methyl-accepting transducer domain] (aa 375-611) (according to UniProt)
  • Modification

  • methylated at residues Gln371, Glu630, and Glu637 [Pubmed|20864474]
  • Effectors of protein activity

  • asparagine (binds to the part of McpB that is exposed to the exterior) [Pubmed|19864420]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711,21515776]
  • localized at the cell poles, but in the presence of high asparagine concentration there is a reversible re-localization to the sides of the cell (lateral clusters) [Pubmed|21098025]
  • Expression and Regulation



    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8188684], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • additional information

  • in minimal medium, McpB is present with 6,200 /- 1,900 molecules per cell [PubMed|21515776]
  • view in new tab

    Biological materials


  • BKE31260 (Δ[gene|E4E1020B799A1B403BDB4847B91B02D64D161AF3|mcpB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCACTTGCTCCTTCAG, downstream forward: _UP4_TAAAAACCGAAAAACAGCGC
  • BKK31260 (Δ[gene|E4E1020B799A1B403BDB4847B91B02D64D161AF3|mcpB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCACTTGCTCCTTCAG, downstream forward: _UP4_TAAAAACCGAAAAACAGCGC
  • References


  • 31792011
  • Original publications

  • 11722727,10825179,8251536,12909020,10196193,15544802,6137212,9194713,2505839,8188684,2105313,12123464,14731274,20864474,18763711,19864420,21098025,21515776,25039821,27899502,31685537