SubtiBank SubtiBank
mcpB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mcpB

membrane-bound chemotaxis receptor, methyl-accepting chemotaxis protein, receptor for asparagine
locus
BSU_31260
pI
5.13
mw
71.70 kDa
protein length
662 aa Sequence Blast
gene length
1989 bp Sequence Blast
function
control of chemotaxis
product
methyl-accepting chemotaxis protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.4|Membrane-bound chemoreceptors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,210,445 → 3,212,433

    The protein

    Paralogous protein(s)

  • [protein|F02E3080214A327E131ECDE0DBC52C57EFDFE2CE|McpA], [protein|4CD44AD8FE68516C84889EAA2137828E06B8A30B|TlpB], [protein|1DE26CDEE952142C1303C822F0E2A63AE09F721B|TlpA]
  • Kinetic information

  • K(D) for asparagine: 14 myM [Pubmed|19864420]
  • [SW|Domains]

  • [SW|Cache domain] (aa 153-229) (according to UniProt)
  • [SW|HAMP domain] (aa 304-356) (according to UniProt)
  • [SW|Methyl-accepting transducer domain] (aa 375-611) (according to UniProt)
  • Modification

  • methylated at residues Gln371, Glu630, and Glu637 [Pubmed|20864474]
  • Effectors of protein activity

  • asparagine (binds to the part of McpB that is exposed to the exterior) [Pubmed|19864420]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711,21515776]
  • localized at the cell poles, but in the presence of high asparagine concentration there is a reversible re-localization to the sides of the cell (lateral clusters) [Pubmed|21098025]
  • Expression and Regulation

    Operons

    genes
    [gene|E4E1020B799A1B403BDB4847B91B02D64D161AF3|mcpB]
    description
    [Pubmed|8188684]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8188684], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • additional information

  • in minimal medium, McpB is present with 6,200 /- 1,900 molecules per cell [PubMed|21515776]
  • view in new tab

    Biological materials

    Mutant

  • BKE31260 (Δ[gene|E4E1020B799A1B403BDB4847B91B02D64D161AF3|mcpB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCACTTGCTCCTTCAG, downstream forward: _UP4_TAAAAACCGAAAAACAGCGC
  • BKK31260 (Δ[gene|E4E1020B799A1B403BDB4847B91B02D64D161AF3|mcpB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCACTTGCTCCTTCAG, downstream forward: _UP4_TAAAAACCGAAAAACAGCGC
  • References

  • 11722727,10825179,8251536,12909020,10196193,15544802,6137212,9194713,2505839,8188684,2105313,12123464,14731274,20864474,18763711,19864420,21098025,21515776,25039821,27899502