SubtiBank SubtiBank
yesU
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yesU

carbohydrate-binding protein, binds fucosylated glycans
locus
BSU_07030
pI
7.71
mw
25.06 kDa
protein length
220 aa Sequence Blast
gene length
663 bp Sequence Blast
function
carbohydrate-binding protein
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    768,828 → 769,490

    The protein

    Structure

  • [PDB|1OQ1]
  • Expression and Regulation

    Operons

    genes
    [gene|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR]-[gene|585CA3154C0405697C4707E5B1D9359963999C54|yesT]-[gene|E4C4AEBA8DAEF7DA1B49432213B2B3EA2AF6B34B|yesU]-[gene|8FE909876A7A21B436CA0CFB90ED190BAD17C8E1|yesV]-[gene|65704140C3B95619D6C0962CB40452D373E2740F|yesW]-[gene|217BAA94FB926CDA7CA8800BC6B08371792CEE31|yesX]-[gene|578B79EB64B804FCAACA73AB22458481371A815C|yesY]-[gene|3226901F1D7C1F21296AB974CAE3656C18BE8F69|yesZ]
    description
    [Pubmed|19651770]

    regulatory mechanism

  • [protein|BF0E202739BFD461E418655ECD9C3425AC556FA3|RhgR]: activation, [Pubmed|19651770], in [regulon|BF0E202739BFD461E418655ECD9C3425AC556FA3|RhgR regulon]
  • regulation

  • induced by pectin ([protein|search|RhgR]) [Pubmed|19651770]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B452 (yesU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1451 NBRP B. subtilis, Japan]
  • BKE07030 (Δ[gene|E4C4AEBA8DAEF7DA1B49432213B2B3EA2AF6B34B|yesU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTGCGGTACAAGCAAGCGC, downstream forward: _UP4_GCCGTGCATCAAGCGGTGAG
  • BKK07030 (Δ[gene|E4C4AEBA8DAEF7DA1B49432213B2B3EA2AF6B34B|yesU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTGCGGTACAAGCAAGCGC, downstream forward: _UP4_GCCGTGCATCAAGCGGTGAG
  • References

  • 19651770,17449691,30177739