SubtiBank SubtiBank
tatAD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tatAD

component of the TatAD-TatCD twin-arginine translocase
locus
BSU02630
pI
9.69
mw
7.37 kDa
protein length
gene length
213 bp Sequence Blast
function
TAT protein secretion
product
component of the twin-arginine translocation pathway
essential
no
synonyms
yczB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.3|Phosphate metabolism]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    285,775 → 285,987

    The protein

    Catalyzed reaction/ biological activity

  • translocation of [protein|597771E2E8EC31ED9B2CC8C0E4D888DEEA80F689|PhoD] [Pubmed|19395490]
  • Protein family

  • tatA/E family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|780FDF3DD260287428B397FFE7F44DDF1917381C|TatAY], [protein|8987552EFDF673776741405F7F5FE004556484CA|TatAC]
  • Structure

  • [PDB|2L16] [Pubmed|20726548]
  • [SW|Localization]

  • membrane (according to Swiss-Prot), forms foci at the division sites and cell poles, localization requires interaction with [protein|A58C9B9BB6574662A44AF0C7A94DFFE368B740E2|TatCD] or [protein|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|TatCY] [Pubmed|19395490]
  • Expression and Regulation

    Operons

    genes
    [gene|597771E2E8EC31ED9B2CC8C0E4D888DEEA80F689|phoD]-[gene|E4395255CD43ACB611E0BA872182DF801662C366|tatAD]-[gene|A58C9B9BB6574662A44AF0C7A94DFFE368B740E2|tatCD]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10094677], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|10094677,11007775], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|10094677]
  • additional information

  • expression of the operon depends on functional [protein|search|HemAT] and [protein|search|CsbC] [PubMed|23180473]
  • view in new tab

    Biological materials

    Mutant

  • BKE02630 (Δ[gene|E4395255CD43ACB611E0BA872182DF801662C366|tatAD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTGAAAACATAATTTCCA, downstream forward: _UP4_TGAATGCTGATGAGGCAGAC
  • BKK02630 (Δ[gene|E4395255CD43ACB611E0BA872182DF801662C366|tatAD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTGAAAACATAATTTCCA, downstream forward: _UP4_TGAATGCTGATGAGGCAGAC
  • labs

  • [SW|Oscar Kuipers], University of Groningen, The Netherlands
  • [http://molgen.biol.rug.nl/molgen/index.php Homepage]
  • References

    Reviews

  • 22683878,24140208,25975269,25494301,27121927
  • Original publications

  • 12867413,15554971,20726548,11007775,19395490,21479178,21479530,22383849,10094677,23180473,23567937,20977272,27984091