SubtiBank SubtiBank
ynzG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ynzG

unknown
locus
BSU_17490
pI
6.55
mw
9.21 kDa
protein length
gene length
252 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,881,098 → 1,881,349

    The protein

    Protein family

  • UPF0457 family (single member, according to UniProt)
  • Biological materials

    Mutant

  • BKE17490 (Δ[gene|E404D34A983A398B7C7B7E527FE9508043889D85|ynzG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACATTCCCCTTTT, downstream forward: _UP4_TAATAAACAGTTTATGTCCC
  • BKK17490 (Δ[gene|E404D34A983A398B7C7B7E527FE9508043889D85|ynzG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACATTCCCCTTTT, downstream forward: _UP4_TAATAAACAGTTTATGTCCC