SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


ATP synthase, part of the F1 complex (subunit alpha)
54.43 kDa
protein length
502 aa Sequence Blast
gene length
1509 bp Sequence Blast
ATP synthesis
ATP synthase (subunit alpha)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.5|ATP synthesis] → [category|SW|ATPase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    3,783,878 → 3,785,386

    The protein

    Catalyzed reaction/ biological activity

  • ATP + 4 H+ + H2O --> ADP + 5 H+ + phosphate (according to UniProt) [ see a video]
  • Protein family

  • ATPase alpha/beta chains family (with [protein|401459F105BC8A8342341D953AE259D6C3868AB6|FliI] and [protein|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|AtpD], according to UniProt)
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
  • Effectors of protein activity

  • ATPase activity is inhibited upon binding of Mg-ADP to [protein|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|AtpD] [pubmed|30580998]
  • Structure

  • [PDB|1SKY] ([protein|E3FADE979CE6AB6315F67812608FCE00CF4E2453|AtpA]-[protein|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|AtpD] complex from ''Bacillus sp.'', 88% identity) [Pubmed|9261073]
  • [PDB|see here an overview on ATPase structure]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • peripheral via theF0 complex
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • the mRNA is processed between [gene|8027AD5C3A92FB9B70E42C119FDEC697A64618C4|atpI] and [gene|CC1894D90AC17487A286B2909964916825055F93|atpB] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials


  • BKE36830 (Δ[gene|E3FADE979CE6AB6315F67812608FCE00CF4E2453|atpA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATGCTCACTTAGGTTTCAC, downstream forward: _UP4_TAACTCGAATGCTGATGAGA
  • BKK36830 (Δ[gene|E3FADE979CE6AB6315F67812608FCE00CF4E2453|atpA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATGCTCACTTAGGTTTCAC, downstream forward: _UP4_TAACTCGAATGCTGATGAGA
  • References


  • 23356252,23341301,23267178,22822068,21524994,19489730,17208001,16730323
  • Research papers

  • 30580998
  • Original publications

  • 7961438,15378759,16493705,18763711,25244289,9261073,26883633