SubtiBank SubtiBank
atpA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

atpA

ATP synthase, part of the F1 complex (subunit alpha)
locus
BSU36830
pI
5.04
mw
54.43 kDa
protein length
502 aa Sequence Blast
gene length
1509 bp Sequence Blast
function
ATP synthesis
product
ATP synthase (subunit alpha)
essential
no
ec
3.6.3.14
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.5|ATP synthesis] → [category|SW 2.1.5.1|ATPase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    Coordinates
    3,783,878 → 3,785,386

    The protein

    Catalyzed reaction/ biological activity

  • ATP + H2O + H+(In) = ADP + phosphate + H+(Out) (according to Swiss-Prot) [http://www.youtube.com/watch?v=uOoHKCMAUMc see a video]
  • Protein family

  • ATPase alpha/beta chains family (according to Swiss-Prot)
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
  • Effectors of protein activity

  • ATPase activity is inhibited upon binding of Mg-ADP to [protein|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|AtpD] [pubmed|30580998]
  • Structure

  • [PDB|1SKY] ([protein|E3FADE979CE6AB6315F67812608FCE00CF4E2453|AtpA]-[protein|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|AtpD] complex from ''Bacillus sp.'', 88% identity) [Pubmed|9261073]
  • [PDB|see here an overview on ATPase structure]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • peripheral via theF0 complex
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|8027AD5C3A92FB9B70E42C119FDEC697A64618C4|atpI]-[gene|CC1894D90AC17487A286B2909964916825055F93|atpB]-[gene|6CF7F6303425D8A51E1E01BF18823139E4259A8F|atpE]-[gene|87311FEA265AD3F5526C78D631E7E51BBF01F0D6|atpF]-[gene|E956A30D97B2941108880F3AD48620C4DB6E0EBD|atpH]-[gene|E3FADE979CE6AB6315F67812608FCE00CF4E2453|atpA]-[gene|492EEC8068043DA770F5DC1D54799C4366AE9A01|atpG]-[gene|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|atpD]-[gene|A9DA64F8C7A60E8E2B1EDC99BEA1BD7DD0135AA6|atpC]
    description
    [Pubmed|9353933]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • the mRNA is processed between [gene|8027AD5C3A92FB9B70E42C119FDEC697A64618C4|atpI] and [gene|CC1894D90AC17487A286B2909964916825055F93|atpB] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • BKE36830 (Δ[gene|E3FADE979CE6AB6315F67812608FCE00CF4E2453|atpA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATGCTCACTTAGGTTTCAC, downstream forward: _UP4_TAACTCGAATGCTGATGAGA
  • BKK36830 (Δ[gene|E3FADE979CE6AB6315F67812608FCE00CF4E2453|atpA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATGCTCACTTAGGTTTCAC, downstream forward: _UP4_TAACTCGAATGCTGATGAGA
  • References

    Reviews

  • 23356252,23341301,23267178,22822068,21524994,19489730,17208001,16730323
  • Research papers

  • 30580998
  • Original publications

  • 7961438,15378759,16493705,18763711,25244289,9261073,26883633