SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


sulphur N-acetylase, required for the conversion of S-methyl-cysteine to cysteine
20.32 kDa
protein length
178 aa Sequence Blast
gene length
537 bp Sequence Blast
utilization of S-methyl-cysteine
sulphur N-acetylase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|Conversion of S-methyl cysteine to cysteine]
  • Gene

    3,008,249 → 3,008,785

    Phenotypes of a mutant

  • reduced growth with S-methyl cysteine [Pubmed|23944997]
  • the ''[gene|E3F1B3A4086DBC40FD9AE9CD6981270FBDFA6CAF|snaA] [gene|EBC2B9107AD50DD8F8174FC0BE4AD90DEE6A7CCA|snaB]'' double mutant does not grow with S-methyl cysteine [Pubmed|23944997]
  • The protein

    Catalyzed reaction/ biological activity

  • N-acetylation of the amino group of S-methyl cysteine [Pubmed|23944997]
  • Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|EBC2B9107AD50DD8F8174FC0BE4AD90DEE6A7CCA|SnaB]
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 4-163) (according to UniProt)
  • Structure

  • [PDB|4ZBG] (from Brucella melitensis, 24% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15272571], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16109943], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [protein|741156D495BE3857683C8A0390764EAD83845ABC|AscR]: activation, [Pubmed|16109943], in [regulon|741156D495BE3857683C8A0390764EAD83845ABC|AscR regulon]
  • regulation

  • induced in the presence of methionine and taurine [Pubmed|11390694]
  • view in new tab

    Biological materials


  • MGNA-A156 (ytmI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE29390 (Δ[gene|E3F1B3A4086DBC40FD9AE9CD6981270FBDFA6CAF|snaA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTGTCACTCCTCTTC, downstream forward: _UP4_TGATGTGAGGCAGCCTATGA
  • BKK29390 (Δ[gene|E3F1B3A4086DBC40FD9AE9CD6981270FBDFA6CAF|snaA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTGTCACTCCTCTTC, downstream forward: _UP4_TGATGTGAGGCAGCCTATGA
  • References

  • 15937167,16109943,15668000,11390694,23944997