SubtiBank SubtiBank
snaA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

snaA

sulphur N-acetylase, required for the conversion of S-methyl-cysteine to cysteine
locus
BSU29390
pI
5.51
mw
20.32 kDa
protein length
178 aa Sequence Blast
gene length
537 bp Sequence Blast
function
utilization of S-methyl-cysteine
product
sulphur N-acetylase
essential
no
synonyms
ytmI

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.1|Conversion of S-methyl cysteine to cysteine]
  • Gene

    Coordinates
    3,008,249 → 3,008,785

    Phenotypes of a mutant

  • reduced growth with S-methyl cysteine [Pubmed|23944997]
  • the ''[gene|E3F1B3A4086DBC40FD9AE9CD6981270FBDFA6CAF|snaA] [gene|EBC2B9107AD50DD8F8174FC0BE4AD90DEE6A7CCA|snaB]'' double mutant does not grow with S-methyl cysteine [Pubmed|23944997]
  • The protein

    Catalyzed reaction/ biological activity

  • N-acetylation of the amino group of S-methyl cysteine [Pubmed|23944997]
  • Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|EBC2B9107AD50DD8F8174FC0BE4AD90DEE6A7CCA|SnaB]
  • Structure

  • [PDB|4ZBG] (from Brucella melitensis, 24% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|E3F1B3A4086DBC40FD9AE9CD6981270FBDFA6CAF|snaA]-[gene|A6A13C54177381CE78ABA2CFC2A3F2CE12099F15|tcyJ]-[gene|A8FA40EACDB15CF53DDDA725A3AA5A6EB654FA8B|tcyK]-[gene|350C97E4A4C60A6E2FF9610D50B4A49FB9F9B42D|tcyL]-[gene|B1DD32A3B3D1C0C5391A40834940257357A2F30F|tcyM]-[gene|B24763A732111026D21C828FF9BE73FB22A123CF|tcyN]-[gene|EDC3565D90D7059A4A4C66A13EB568420F6CECD4|cmoO]-[gene|FCD25CA4414D689B217F54B0C44EB805F9590454|cmoI]-[gene|8145952307BC47805A7A9BD39418474358043BFE|cmoJ]-[gene|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR]-[gene|0DE66A10D9475DC57A140561E8532D3EC038FD6F|sndA]-[gene|910EAAF48C85D0364751EC9585121246AF677431|ytnM]
    description
    [Pubmed|15668000]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15272571], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16109943], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [protein|741156D495BE3857683C8A0390764EAD83845ABC|AscR]: activation, [Pubmed|16109943], in [regulon|741156D495BE3857683C8A0390764EAD83845ABC|AscR regulon]
  • regulation

  • induced in the presence of methionine and taurine [Pubmed|11390694]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A156 (ytmI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/156 NBRP B. subtilis, Japan]
  • BKE29390 (Δ[gene|E3F1B3A4086DBC40FD9AE9CD6981270FBDFA6CAF|snaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTGTCACTCCTCTTC, downstream forward: _UP4_TGATGTGAGGCAGCCTATGA
  • BKK29390 (Δ[gene|E3F1B3A4086DBC40FD9AE9CD6981270FBDFA6CAF|snaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTGTCACTCCTCTTC, downstream forward: _UP4_TGATGTGAGGCAGCCTATGA
  • References

  • 15937167,16109943,15668000,11390694,23944997