SubtiBank SubtiBank
yxiT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxiT

unknown
locus
BSU_39030
pI
0.00
mw
0.00 kDa
protein length
gene length
243 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    4,007,416 → 4,007,658

    Expression and Regulation

    Operons

    genes
    [gene|E3E0B71330867F97495608CAF9DD090B601D3DA2|yxiT]
    description
    [Pubmed|10746760]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B798 (yxiT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1797 NBRP B. subtilis, Japan]
  • BKE39030 (Δ[gene|E3E0B71330867F97495608CAF9DD090B601D3DA2|yxiT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAATCTACTCCTTTGA, downstream forward: _UP4_AACAATCGTATCAGGAATAC
  • BKK39030 (Δ[gene|E3E0B71330867F97495608CAF9DD090B601D3DA2|yxiT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAATCTACTCCTTTGA, downstream forward: _UP4_AACAATCGTATCAGGAATAC