SubtiBank SubtiBank
pgi
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pgi

glucose 6-phosphate isomerase, glycolytic / gluconeogenic enzyme
locus
BSU_31350
pI
4.85
mw
50.36 kDa
protein length
451 aa Sequence Blast
gene length
1353 bp Sequence Blast
function
enzyme in glycolysis / gluconeogenesis
product
glucose-6-phosphate isomerase
essential
no
ec
5.3.1.9
synonyms
yugL

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.1|Glycolysis]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.2|Gluconeogenesis]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    Coordinates
    3,220,731 → 3,222,083

    Phenotypes of a mutant

  • poorly transformable [pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • aldehydo-D-glucose 6-phosphate --> keto-D-fructose 6-phosphate (according to UniProt)
  • Protein family

  • GPI family (single member, according to UniProt)
  • Modification

  • phosphorylation on Thr-39 [Pubmed|17218307]
  • phosphorylated on Arg-5 [Pubmed|31221751]
  • Effectors of protein activity

  • competitively inhibited by 6-phosphogluconate (in ''B.caldotenax, B.stearothermophilus'') [Pubmed|7400125]
  • Structure

  • [PDB|1B0Z] (''Geobacillus stearothermophilus''), [http://www.proteopedia.org/wiki/index.php/2pgi 2PGI] (''Geobacillus stearothermophilus'')
  • [SW|Localization]

  • cytoplasm (homogeneously distributed throughout the cell) [Pubmed|24825009]
  • Additional information

  • extensive information on the structure and enzymatic properties of Pgi can be found at [http://www.proteopedia.org/wiki/index.php/Phosphoglucose_isomerase Proteopedia]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|E3DAC5DE86EE0E34C6ECB6DE1E41309742465CF9|pgi]-[gene|BD63E58F9CF99F9A1888099F3393B30DE3F164F5|yugM]-[gene|0C8E5DFD40F4B2EB540199DFB2520E3FBC878530|yugN]
    description
    [Pubmed|11489127]

    regulation

  • constitutively expressed [Pubmed|11489127]
  • view in new tab

    Biological materials

    Mutant

  • GP508 (spc), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]
  • GP1746: BSB1 ''pgi::aphA3'', available in [SW|Jörg Stülke]' lab
  • BKE31350 (Δ[gene|E3DAC5DE86EE0E34C6ECB6DE1E41309742465CF9|pgi]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTGTCCCTCCATAA, downstream forward: _UP4_TAATGTGAGAAAGCTGACTG
  • BKK31350 (Δ[gene|E3DAC5DE86EE0E34C6ECB6DE1E41309742465CF9|pgi]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTGTCCCTCCATAA, downstream forward: _UP4_TAATGTGAGAAAGCTGACTG
  • Expression vectors

  • pGP398 (N-terminal His-tag, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP510 (in [SW|pAC6]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab, [pubmed|19193632]
  • labs

  • [SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html homepage]
  • References

  • 17218307,19052382,4214896,23420519,11489127,4275311,11491085,17218307,24571712,15378759,24825009,28189581,31221751