SubtiBank SubtiBank
glnT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

glnT

glutamine transporter (proton symport)
locus
BSU02420
pI
10.13
mw
49.83 kDa
protein length
478 aa Sequence Blast
gene length
1437 bp Sequence Blast
function
glutamine uptake
product
glutamine transporter (proton symport)
essential
no
synonyms
ybgH

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.1|Solute:sodium symporter family]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.1|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.1|Utilization of glutamine/ glutamate]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    262,732 → 264,168

    The protein

    Protein family

  • [SW|Alanine or glycine:cation symporter (AGCS) (TC 2.A.25) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B84BE9F5BEFE3A295ED5580D66040CD28609A6A1|AlsT], [protein|A69E7536DFE6353C4CD1B09D1258C88BF0FB8B4D|YflA], [protein|A10EA56A7EDA2DF712B5BB87D94A818E39940B44|YrbD]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|1A415DC85354373EA4866733C3AE43F510BD3C56|glsA]-[gene|E371BC4F613C40CB0E8C8CAA97387F3E6735D813|glnT]
    description
    [Pubmed|15995196]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15995196], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|4E6EA2EABBDAA427E8F9EE1AE1800AF8657CF18B|GlnL]: activation, [Pubmed|15995196], in [regulon|4E6EA2EABBDAA427E8F9EE1AE1800AF8657CF18B|GlnL regulon]
  • regulation

  • induced in the presence of glutamine ([protein|search|GlnL]) [Pubmed|15995196]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B942 (ybgH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1941 NBRP B. subtilis, Japan]
  • BKE02420 (Δ[gene|E371BC4F613C40CB0E8C8CAA97387F3E6735D813|glnT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGAATCACCTCTTTTTT, downstream forward: _UP4_TAAGAAAAGGGTGTTCAGAC
  • BKK02420 (Δ[gene|E371BC4F613C40CB0E8C8CAA97387F3E6735D813|glnT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGAATCACCTCTTTTTT, downstream forward: _UP4_TAAGAAAAGGGTGTTCAGAC
  • References

  • 15995196