SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


glutamine transporter (proton symport)
49.83 kDa
protein length
478 aa Sequence Blast
gene length
1437 bp Sequence Blast
glutamine uptake
glutamine transporter (proton symport)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|Solute:sodium symporter family]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of glutamine/ glutamate]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    262,732 → 264,168

    The protein

    Protein family

  • [SW|Alanine or glycine:cation symporter (AGCS) (TC 2.A.25) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B84BE9F5BEFE3A295ED5580D66040CD28609A6A1|AlsT], [protein|A69E7536DFE6353C4CD1B09D1258C88BF0FB8B4D|YflA], [protein|A10EA56A7EDA2DF712B5BB87D94A818E39940B44|YrbD]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15995196], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|4E6EA2EABBDAA427E8F9EE1AE1800AF8657CF18B|GlnL]: activation, [Pubmed|15995196], in [regulon|4E6EA2EABBDAA427E8F9EE1AE1800AF8657CF18B|GlnL regulon]
  • regulation

  • induced in the presence of glutamine ([protein|search|GlnL]) [Pubmed|15995196]
  • view in new tab

    Biological materials


  • MGNA-B942 (ybgH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE02420 (Δ[gene|E371BC4F613C40CB0E8C8CAA97387F3E6735D813|glnT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGAATCACCTCTTTTTT, downstream forward: _UP4_TAAGAAAAGGGTGTTCAGAC
  • BKK02420 (Δ[gene|E371BC4F613C40CB0E8C8CAA97387F3E6735D813|glnT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGAATCACCTCTTTTTT, downstream forward: _UP4_TAAGAAAAGGGTGTTCAGAC
  • References

  • 15995196