SubtiBank SubtiBank
yjcM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjcM

unknown
locus
BSU_11910
pI
9.11
mw
46.41 kDa
protein length
409 aa Sequence Blast
gene length
1230 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,263,702 → 1,264,931

    The protein

    [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|E3603BC23B04BA806F008EF13C6CDA23ADDAC7D8|yjcM]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B300 (yjcM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1299 NBRP B. subtilis, Japan]
  • BKE11910 (Δ[gene|E3603BC23B04BA806F008EF13C6CDA23ADDAC7D8|yjcM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGAAACCTCCAATAAA, downstream forward: _UP4_TAATAAATTGATACTAAATC
  • BKK11910 (Δ[gene|E3603BC23B04BA806F008EF13C6CDA23ADDAC7D8|yjcM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGAAACCTCCAATAAA, downstream forward: _UP4_TAATAAATTGATACTAAATC
  • References

  • 18957862,20817675,26577401