SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


46.41 kDa
protein length
409 aa Sequence Blast
gene length
1230 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,263,702 → 1,264,931

    The protein


  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials


  • MGNA-B300 (yjcM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE11910 (Δ[gene|E3603BC23B04BA806F008EF13C6CDA23ADDAC7D8|yjcM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGAAACCTCCAATAAA, downstream forward: _UP4_TAATAAATTGATACTAAATC
  • BKK11910 (Δ[gene|E3603BC23B04BA806F008EF13C6CDA23ADDAC7D8|yjcM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGAAACCTCCAATAAA, downstream forward: _UP4_TAATAAATTGATACTAAATC
  • References

  • 18957862,20817675,26577401