SubtiBank SubtiBank
yqbD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqbD

similar to phage-related protein
locus
BSU_26150
pI
4.85
mw
36.09 kDa
protein length
322 aa Sequence Blast
gene length
969 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,684,161 → 2,685,129

    Biological materials

    Mutant

  • BKE26150 (Δ[gene|E338967EA41E8BA63E471FCE8393EAF33555767A|yqbD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATTCACCTCCTTAA, downstream forward: _UP4_TTTTAATGGATAAGGAGGAT
  • BKK26150 (Δ[gene|E338967EA41E8BA63E471FCE8393EAF33555767A|yqbD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATTCACCTCCTTAA, downstream forward: _UP4_TTTTAATGGATAAGGAGGAT
  • References

  • 21630458