SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


similar to phage-related protein
36.09 kDa
protein length
322 aa Sequence Blast
gene length
969 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    2,684,161 → 2,685,129

    Biological materials


  • BKE26150 (Δ[gene|E338967EA41E8BA63E471FCE8393EAF33555767A|yqbD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATTCACCTCCTTAA, downstream forward: _UP4_TTTTAATGGATAAGGAGGAT
  • BKK26150 (Δ[gene|E338967EA41E8BA63E471FCE8393EAF33555767A|yqbD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATTCACCTCCTTAA, downstream forward: _UP4_TTTTAATGGATAAGGAGGAT
  • References

  • 21630458