SubtiBank SubtiBank
yqbD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqbD

similar to phage-related protein
locus
BSU26150
pI
4.85
mw
36.09 kDa
protein length
322 aa Sequence Blast
gene length
969 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,684,161 → 2,685,129

    Biological materials

    Mutant

  • BKE26150 (Δ[gene|E338967EA41E8BA63E471FCE8393EAF33555767A|yqbD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATTCACCTCCTTAA, downstream forward: _UP4_TTTTAATGGATAAGGAGGAT
  • BKK26150 (Δ[gene|E338967EA41E8BA63E471FCE8393EAF33555767A|yqbD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATTCACCTCCTTAA, downstream forward: _UP4_TTTTAATGGATAAGGAGGAT
  • References

  • 21630458