SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


similar to phage-related protein
9.41 kDa
protein length
gene length
264 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    2,670,801 → 2,671,064

    Biological materials


  • BKE26000 (Δ[gene|E30EA72A22EE52EBE5D65E6ADF2F6A8A1C2476BA|yqbR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTCATGAGGAAACACCATC, downstream forward: _UP4_GACAAAATATAGGAGGTGTT
  • BKK26000 (Δ[gene|E30EA72A22EE52EBE5D65E6ADF2F6A8A1C2476BA|yqbR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTCATGAGGAAACACCATC, downstream forward: _UP4_GACAAAATATAGGAGGTGTT