SubtiBank SubtiBank
ydaT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydaT

general stress protein, survival of ethanol stress and low temperatures
locus
BSU_04380
pI
5.97
mw
16.42 kDa
protein length
150 aa Sequence Blast
gene length
453 bp Sequence Blast
function
survival of ethanol stress and low temperatures
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    492,989 → 493,441

    Expression and Regulation

    Operons

    genes
    [gene|E30C92E8D0CC56F7406B87B7EA25B7C41086DD73|ydaT]-[gene|7601A53CE6A8AD417AADBED3199DB46B285D9059|ydaS]
    description
    [Pubmed|10482513]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10482513], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C091 (ydaT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2089 NBRP B. subtilis, Japan]
  • BKE04380 (Δ[gene|E30C92E8D0CC56F7406B87B7EA25B7C41086DD73|ydaT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTATCACTCCTTTTC, downstream forward: _UP4_TAAAGGAATATGCTTTCAAG
  • BKK04380 (Δ[gene|E30C92E8D0CC56F7406B87B7EA25B7C41086DD73|ydaT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTATCACTCCTTTTC, downstream forward: _UP4_TAAAGGAATATGCTTTCAAG
  • References

  • 15805528,10482513,23033921