SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


general stress protein, survival of ethanol stress and low temperatures
16.42 kDa
protein length
150 aa Sequence Blast
gene length
453 bp Sequence Blast
survival of ethanol stress and low temperatures

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    492,989 → 493,441

    Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10482513], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials


  • MGNA-C091 (ydaT::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE04380 (Δ[gene|E30C92E8D0CC56F7406B87B7EA25B7C41086DD73|ydaT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTATCACTCCTTTTC, downstream forward: _UP4_TAAAGGAATATGCTTTCAAG
  • BKK04380 (Δ[gene|E30C92E8D0CC56F7406B87B7EA25B7C41086DD73|ydaT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTATCACTCCTTTTC, downstream forward: _UP4_TAAAGGAATATGCTTTCAAG
  • References

  • 15805528,10482513,23033921