SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


17.70 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,043,186 → 2,043,668

    Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B400 (yoaS::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE18730 (Δ[gene|E2F9D7C9BC9166AD462E0017F50BDD9ECF9C6835|yoaS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAAGCACCTCATTTA, downstream forward: _UP4_GACTTAACGGTCTGAGGTGA
  • BKK18730 (Δ[gene|E2F9D7C9BC9166AD462E0017F50BDD9ECF9C6835|yoaS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAAGCACCTCATTTA, downstream forward: _UP4_GACTTAACGGTCTGAGGTGA