SubtiBank SubtiBank
yoaS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yoaS

unknown
locus
BSU_18730
pI
9.07
mw
17.70 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,043,186 → 2,043,668

    Expression and Regulation

    Operons

    genes
    [gene|E2F9D7C9BC9166AD462E0017F50BDD9ECF9C6835|yoaS]-[gene|10484E5BB5DC0117CDE97036AF82F04F07926AEF|yozG]-[gene|694BC1E02DBAC48CC2BEEFCADED7889BC18E363C|yoaT]-[gene|A23D34C5D38A48144B062C3BAF9BDF38CEA1207F|yoaV]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B400 (yoaS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1399 NBRP B. subtilis, Japan]
  • BKE18730 (Δ[gene|E2F9D7C9BC9166AD462E0017F50BDD9ECF9C6835|yoaS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAAGCACCTCATTTA, downstream forward: _UP4_GACTTAACGGTCTGAGGTGA
  • BKK18730 (Δ[gene|E2F9D7C9BC9166AD462E0017F50BDD9ECF9C6835|yoaS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAAGCACCTCATTTA, downstream forward: _UP4_GACTTAACGGTCTGAGGTGA