SubtiBank SubtiBank
ypuA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ypuA

unknown
locus
BSU_23370
pI
4.51
mw
31.14 kDa
protein length
290 aa Sequence Blast
gene length
873 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    2,436,045 → 2,436,917

    The protein

    [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|E2F68B264B8B1D956F743EEC884A69D86A24B799|ypuA]
    description
    [Pubmed|7934830]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulation

  • expressed under stress conditions ([protein|search|SigM]) [Pubmed|17434969]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A100 (ypuA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/100 NBRP B. subtilis, Japan]
  • BKE23370 (Δ[gene|E2F68B264B8B1D956F743EEC884A69D86A24B799|ypuA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGCAGTTTGACCTCCTT, downstream forward: _UP4_TAAGAAAAGCGCCGAAAAAT
  • BKK23370 (Δ[gene|E2F68B264B8B1D956F743EEC884A69D86A24B799|ypuA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGCAGTTTGACCTCCTT, downstream forward: _UP4_TAAGAAAAGCGCCGAAAAAT
  • References

  • 7934830,24706874,17434969