SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


DNA mismatch repair (mismatch recognition protein)
97.39 kDa
protein length
858 aa Sequence Blast
gene length
2577 bp Sequence Blast
DNA repair
mismatch recognition protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Mismatch repair (MMR)]
  • Gene

    1,775,745 → 1,778,321

    Phenotypes of a mutant

  • 60-fold increased mutation rate [Pubmed|23882084]
  • a ''[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB] [gene|E2A8B04CD729332F9E6A13195181983F751F2F25|mutS]-[gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]'' mutant is not viable [Pubmed|23882084]
  • The protein

    Catalyzed reaction/ biological activity

  • MutS recognizes mismatches in the DNA and recruits [protein|A86A013EDCE59D7EF84FB836A751E66C58CADF45|MutL] to the site of mismatch recognition
  • assists DNA strand exchange by facilitating [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] disassembly, and indirectly re-engagement with the homologous 5'-end of the linear duplex [pubmed|30814990]
  • modulates bidirectional [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA]-mediated integration of divergent sequences [pubmed|30814990]
  • Protein family

  • DNA mismatch repair mutS family (with [protein|F8E82D9AE514B31892FE4530532691274ADA682B|MutSB], according to UniProt)
  • Structure

  • [PDB|1NG9] (from ''E. coli'', 39% identity) [Pubmed|12554674]
  • [SW|Localization]

  • forms foci at midcell position, the frequency of foci increases upon mismatch formation [Pubmed|21958350]
  • replication-active region of the DNA, via [protein|83E05071DEC874248D3E96B8F3A093C65939B314|DnaN] [Pubmed|23228104]
  • MutS dynamics are heterogeneous in cells, with one MutS population exploring the nucleoid rapidly, while another MutS population moves to and transiently dwells at the [SW|replisome] region, even in the absence of appreciable mismatch formation [Pubmed|26575623]
  • Expression and Regulation



    additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|mutL]' and '[protein|search|ymzD]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • GP1190 (Δ[gene|E2A8B04CD729332F9E6A13195181983F751F2F25|mutS]-[gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]::''aphA3'') [Pubmed|22178973], available in [SW|Jörg Stülke]'s lab
  • 1A833 ( ''mutS''::''spec''), [Pubmed|11779496], available at [ Bacillus Genetic Stock Center]
  • BKE17040 (Δ[gene|E2A8B04CD729332F9E6A13195181983F751F2F25|mutS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTAATCCCTCACTA, downstream forward: _UP4_TTACATTAAAACGGGGTGAT
  • BKK17040 (Δ[gene|E2A8B04CD729332F9E6A13195181983F751F2F25|mutS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTAATCCCTCACTA, downstream forward: _UP4_TTACATTAAAACGGGGTGAT
  • References


  • 22933559,26354434,24629484,26343983,29197672
  • Original publications

  • 8760914,15375129,16479537,20525796,20453097,23228104,21958350,23882084,23998896,24062730,12554674,25326311,26163658,26575623,27851738,29939310,30272207,30814990