SubtiBank SubtiBank
mutS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mutS

DNA mismatch repair (mismatch recognition protein)
locus
BSU_17040
pI
5.19
mw
97.39 kDa
protein length
858 aa Sequence Blast
gene length
2577 bp Sequence Blast
function
DNA repair
product
mismatch recognition protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.7|Mismatch repair (MMR)]
  • Gene

    Coordinates
    1,775,745 → 1,778,321

    Phenotypes of a mutant

  • 60-fold increased mutation rate [Pubmed|23882084]
  • a ''[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB] [gene|E2A8B04CD729332F9E6A13195181983F751F2F25|mutS]-[gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]'' mutant is not viable [Pubmed|23882084]
  • The protein

    Catalyzed reaction/ biological activity

  • MutS recognizes mismatches in the DNA and recruits [protein|A86A013EDCE59D7EF84FB836A751E66C58CADF45|MutL] to the site of mismatch recognition
  • assists DNA strand exchange by facilitating [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] disassembly, and indirectly re-engagement with the homologous 5'-end of the linear duplex [pubmed|30814990]
  • modulates bidirectional [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA]-mediated integration of divergent sequences [pubmed|30814990]
  • Protein family

  • DNA mismatch repair mutS family (with [protein|F8E82D9AE514B31892FE4530532691274ADA682B|MutSB], according to UniProt)
  • Structure

  • [PDB|1NG9] (from ''E. coli'', 39% identity) [Pubmed|12554674]
  • [SW|Localization]

  • forms foci at midcell position, the frequency of foci increases upon mismatch formation [Pubmed|21958350]
  • replication-active region of the DNA, via [protein|83E05071DEC874248D3E96B8F3A093C65939B314|DnaN] [Pubmed|23228104]
  • MutS dynamics are heterogeneous in cells, with one MutS population exploring the nucleoid rapidly, while another MutS population moves to and transiently dwells at the [SW|replisome] region, even in the absence of appreciable mismatch formation [Pubmed|26575623]
  • Expression and Regulation

    Operons

    genes
    [gene|E2A8B04CD729332F9E6A13195181983F751F2F25|mutS]-[gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]
    description
    [Pubmed|8760914]

    additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|mutL]' and '[protein|search|ymzD]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • GP1190 (Δ[gene|E2A8B04CD729332F9E6A13195181983F751F2F25|mutS]-[gene|A86A013EDCE59D7EF84FB836A751E66C58CADF45|mutL]::''aphA3'') [Pubmed|22178973], available in [SW|Jörg Stülke]'s lab
  • 1A833 ( ''mutS''::''spec''), [Pubmed|11779496], available at [http://bgsc.org/getdetail.php?bgscid=1A833 Bacillus Genetic Stock Center]
  • BKE17040 (Δ[gene|E2A8B04CD729332F9E6A13195181983F751F2F25|mutS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTAATCCCTCACTA, downstream forward: _UP4_TTACATTAAAACGGGGTGAT
  • BKK17040 (Δ[gene|E2A8B04CD729332F9E6A13195181983F751F2F25|mutS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTAATCCCTCACTA, downstream forward: _UP4_TTACATTAAAACGGGGTGAT
  • References

    Reviews

  • 22933559,26354434,24629484,26343983,29197672
  • Original publications

  • 8760914,15375129,16479537,20525796,20453097,23228104,21958350,23882084,23998896,24062730,12554674,25326311,26163658,26575623,27851738,29939310,30272207,30814990