SubtiBank SubtiBank
ggaA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ggaA

galactosamine-containing minor teichoic acid biosynthesis
locus
BSU_35690
pI
9.06
mw
52.98 kDa
protein length
446 aa Sequence Blast
gene length
1341 bp Sequence Blast
function
biosynthesis of teichoic acid
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.4|Biosynthesis of teichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.3|Biosynthesis of teichoic acid]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    3,670,035 → 3,671,375

    The protein

    Protein family

  • [SW|glycosyltransferase 2 family] (according to UniProt)
  • Modification

  • phosphorylated on Arg-85 [Pubmed|22517742]
  • Structure

  • [PDB|5HEA] (from Streptococcus parasanguinis,N-terminal domain, 32% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|E29B4702C23AFC774752502FD6C98E43C37BC788|ggaA]-[gene|581759D8BD30CFC04968AC8941D972E49BE89654|ggaB]
    description
    [Pubmed|16735734]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16735734], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • an [SW|ncRNA|antisense RNA] is predicted for [gene|E29B4702C23AFC774752502FD6C98E43C37BC788|ggaA] [PubMed|20525796]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]∼P binds to the promoter region, but regulation has not been explored [pubmed|25666134]
  • view in new tab

    Biological materials

    Mutant

  • BKE35690 (Δ[gene|E29B4702C23AFC774752502FD6C98E43C37BC788|ggaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTGTACCTCTTTATT, downstream forward: _UP4_TAAGGAATGCTTTTCATACA
  • BKK35690 (Δ[gene|E29B4702C23AFC774752502FD6C98E43C37BC788|ggaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTGTACCTCTTTATT, downstream forward: _UP4_TAAGGAATGCTTTTCATACA
  • References

  • 16735734,20525796,22517742,25666134