SubtiBank SubtiBank
yjoB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yjoB

AAA family, ATPase activity , similar to cell-division protein [protein|4E7B9426CED372AA8A321A147116A3A589FBF20C|FtsH]
locus
BSU_12420
pI
4.73
mw
48.61 kDa
protein length
423 aa Sequence Blast
gene length
1272 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.9|Cell division/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    1,314,453 → 1,315,724

    The protein

    Protein family

  • [SW|AAA ATPase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|4E7B9426CED372AA8A321A147116A3A589FBF20C|FtsH]
  • Structure

  • [PDB|1LV7] (AAA domain of E. coli [protein|4E7B9426CED372AA8A321A147116A3A589FBF20C|FtsH], correponds to aa 210 ... 400 of YjoB, 32% identity) [pubmed|12176385]
  • Expression and Regulation

    Operons

    genes
    [gene|E278CCD5CFD618A0D4ACB92E1E06DCC1B4570ED0|yjoB]
    description
    [Pubmed|1378051]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A031 (yjoB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/31 NBRP B. subtilis, Japan]
  • BKE12420 (Δ[gene|E278CCD5CFD618A0D4ACB92E1E06DCC1B4570ED0|yjoB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTATACTCCATTTCA, downstream forward: _UP4_TAAAAGAAAGCACGGGTGTT
  • BKK12420 (Δ[gene|E278CCD5CFD618A0D4ACB92E1E06DCC1B4570ED0|yjoB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTATACTCCATTTCA, downstream forward: _UP4_TAAAAGAAAGCACGGGTGTT
  • References

  • 14757246,1378051,9987136,12176385