SubtiBank SubtiBank
hmp
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

hmp

flavohemoglobin, involved in resistance to nitric oxide (NO), essential for long-term survival under anaerobic conditions
locus
BSU_13040
pI
5.70
mw
44.57 kDa
protein length
399 aa Sequence Blast
gene length
1200 bp Sequence Blast
function
resistance to NO
product
flavohemoglobin
essential
no
synonyms
ykiA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • Gene

    Coordinates
    1,372,792 → 1,373,991

    The protein

    Catalyzed reaction/ biological activity

  • NADPH + 2 nitric oxide + 2 O2 --> H+ + NADP+ + 2 nitrate (according to UniProt)
  • NADH + 2 nitric oxide + 2 O2 --> H+ + NAD+ + 2 nitrate (according to UniProt)
  • Protein family

  • globin family (single member, according to UniProt)
  • C-terminal part: flavoprotein pyridine nucleotide cytochrome reductase family (single member, according to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|1CQX] (from Ralstonia eutropha, 47% identity) [pubmed|8557026]
  • Expression and Regulation

    Operons

    genes
    [gene|E272A68088B689873CE3269CFDD2DD830F3AB3E4|hmp]
    description
    [Pubmed|8682784]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8682784], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|10972836], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|EC6697D5D945B7E5083AFED9218748763C443278|NsrR]: repression, [Pubmed|16885456], in [regulon|EC6697D5D945B7E5083AFED9218748763C443278|NsrR regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab

    genes
    [gene|E272A68088B689873CE3269CFDD2DD830F3AB3E4|hmp]-[gene|5688E6CB20A55856F4A4D893CED3D54BA21209AE|ykjA]
    description
    [Pubmed|22383849]

    regulation

  • expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab

    Biological materials

    Mutant

  • BKE13040 (Δ[gene|E272A68088B689873CE3269CFDD2DD830F3AB3E4|hmp]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATAAACAATCCTTT, downstream forward: _UP4_TGAACACATACATGAAACTC
  • BKK13040 (Δ[gene|E272A68088B689873CE3269CFDD2DD830F3AB3E4|hmp]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATAAACAATCCTTT, downstream forward: _UP4_TGAACACATACATGAAACTC
  • References

  • 8682784,15231799,24214949,10972836,16885456,18487332,16923910,22383849,28439033,8557026