SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


flavohemoglobin, involved in resistance to nitric oxide (NO), essential for long-term survival under anaerobic conditions
44.57 kDa
protein length
399 aa Sequence Blast
gene length
1200 bp Sequence Blast
resistance to NO

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • Gene

    1,372,792 → 1,373,991

    The protein

    Catalyzed reaction/ biological activity

  • NADPH + 2 nitric oxide + 2 O2 --> H+ + NADP+ + 2 nitrate (according to UniProt)
  • NADH + 2 nitric oxide + 2 O2 --> H+ + NAD+ + 2 nitrate (according to UniProt)
  • Protein family

  • globin family (single member, according to UniProt)
  • C-terminal part: flavoprotein pyridine nucleotide cytochrome reductase family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|FAD-binding FR-type domain] (aa 152-255) (according to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|1CQX] (from Ralstonia eutropha, 47% identity) [pubmed|8557026]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8682784], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|10972836], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|EC6697D5D945B7E5083AFED9218748763C443278|NsrR]: repression, [Pubmed|16885456], in [regulon|EC6697D5D945B7E5083AFED9218748763C443278|NsrR regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab



  • expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab

    Biological materials


  • BKE13040 (Δ[gene|E272A68088B689873CE3269CFDD2DD830F3AB3E4|hmp]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATAAACAATCCTTT, downstream forward: _UP4_TGAACACATACATGAAACTC
  • BKK13040 (Δ[gene|E272A68088B689873CE3269CFDD2DD830F3AB3E4|hmp]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATAAACAATCCTTT, downstream forward: _UP4_TGAACACATACATGAAACTC
  • References

  • 8682784,15231799,24214949,10972836,16885456,18487332,16923910,22383849,28439033,8557026