SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


flavohemoglobin, involved in resistance to nitric oxide (NO), essential for long-term survival under anaerobic conditions
44.57 kDa
protein length
399 aa Sequence Blast
gene length
1200 bp Sequence Blast
resistance to NO

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • Gene

    1,372,792 → 1,373,991

    The protein

    Catalyzed reaction/ biological activity

  • NADPH + 2 nitric oxide + 2 O2 --> H+ + NADP+ + 2 nitrate (according to UniProt)
  • NADH + 2 nitric oxide + 2 O2 --> H+ + NAD+ + 2 nitrate (according to UniProt)
  • Protein family

  • globin family (single member, according to UniProt)
  • C-terminal part: flavoprotein pyridine nucleotide cytochrome reductase family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|FAD-binding FR-type domain] (aa 152-255) (according to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|1CQX] (from Ralstonia eutropha, 47% identity) [pubmed|8557026]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8682784], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|10972836], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|EC6697D5D945B7E5083AFED9218748763C443278|NsrR]: repression, [Pubmed|16885456], in [regulon|EC6697D5D945B7E5083AFED9218748763C443278|NsrR regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab



  • expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab

    Biological materials


  • BKE13040 (Δ[gene|E272A68088B689873CE3269CFDD2DD830F3AB3E4|hmp]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATAAACAATCCTTT, downstream forward: _UP4_TGAACACATACATGAAACTC
  • BKK13040 (Δ[gene|E272A68088B689873CE3269CFDD2DD830F3AB3E4|hmp]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATAAACAATCCTTT, downstream forward: _UP4_TGAACACATACATGAAACTC
  • References

  • 8682784,15231799,24214949,10972836,16885456,18487332,16923910,22383849,28439033,8557026