SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


spore coat alanine racemase
43.49 kDa
protein length
394 aa Sequence Blast
gene length
1182 bp Sequence Blast
protection of the spore
spore coat alanine racemase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Class II]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    1,897,941 → 1,899,125

    The protein

    Catalyzed reaction/ biological activity

  • L-alanine --> D-alanine (according to UniProt)
  • Protein family

  • alanine racemase family (with [protein|CB0B6C69CB5CFF6FE30C3F95991F309C8DE1E344|Alr], according to UniProt)
  • Paralogous protein(s)

  • [protein|CB0B6C69CB5CFF6FE30C3F95991F309C8DE1E344|Alr]
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|5IRP] (from Bacillus subtilis 100% identity)
  • [PDB|6Q70] (crystallized with HEPES) [Pubmed|30977502]
  • [PDB|6Q71] (crystallized with Bis-Tris Propane) [Pubmed|30977502]
  • [PDB|6Q72] [Pubmed|30977502]
  • [SW|Localization]

  • outer spore coat, localization depends on [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|CotE] [Pubmed|22171814]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,14523133], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|15699190,14523133]
  • view in new tab

    Biological materials


  • MGNA-B099 (yncD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE17640 (Δ[gene|E267F2B6448E380B354AE091734E4AC4DB5825EF|yncD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAACGCTTCCTTCCTTC, downstream forward: _UP4_TAGAACATCTTAAAATGCTG
  • BKK17640 (Δ[gene|E267F2B6448E380B354AE091734E4AC4DB5825EF|yncD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAACGCTTCCTTCCTTC, downstream forward: _UP4_TAGAACATCTTAAAATGCTG
  • References


  • 23202530
  • Original publications

  • 18399999,15699190,14523133,22171814,30977502