SubtiBank SubtiBank
yncD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yncD

spore coat alanine racemase
locus
BSU_17640
pI
9.59
mw
43.49 kDa
protein length
394 aa Sequence Blast
gene length
1182 bp Sequence Blast
function
protection of the spore
product
spore coat alanine racemase
essential
no
ec
5.1.1.1
synonyms
alrB

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.2|Class II]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,897,941 → 1,899,125

    The protein

    Catalyzed reaction/ biological activity

  • L-alanine --> D-alanine (according to UniProt)
  • Protein family

  • alanine racemase family (with [protein|CB0B6C69CB5CFF6FE30C3F95991F309C8DE1E344|Alr], according to UniProt)
  • Paralogous protein(s)

  • [protein|CB0B6C69CB5CFF6FE30C3F95991F309C8DE1E344|Alr]
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|5IRP] (from Bacillus subtilis 100% identity)
  • [PDB|6Q70] (crystallized with HEPES) [Pubmed|30977502]
  • [PDB|6Q71] (crystallized with Bis-Tris Propane) [Pubmed|30977502]
  • [PDB|6Q72] [Pubmed|30977502]
  • [SW|Localization]

  • outer spore coat, localization depends on [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|CotE] [Pubmed|22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|E267F2B6448E380B354AE091734E4AC4DB5825EF|yncD]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,14523133], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|15699190,14523133]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B099 (yncD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1098 NBRP B. subtilis, Japan]
  • BKE17640 (Δ[gene|E267F2B6448E380B354AE091734E4AC4DB5825EF|yncD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAACGCTTCCTTCCTTC, downstream forward: _UP4_TAGAACATCTTAAAATGCTG
  • BKK17640 (Δ[gene|E267F2B6448E380B354AE091734E4AC4DB5825EF|yncD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAACGCTTCCTTCCTTC, downstream forward: _UP4_TAGAACATCTTAAAATGCTG
  • References

    Reviews

  • 23202530
  • Original publications

  • 18399999,15699190,14523133,22171814,30977502