SubtiBank SubtiBank
mtnK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mtnK

5-methylthioribose kinase
locus
BSU_13560
pI
4.86
mw
45.19 kDa
protein length
399 aa Sequence Blast
gene length
1200 bp Sequence Blast
function
methionine salvage
product
5-methylthioribose kinase
essential
no
ec
2.7.1.100
synonyms
ykrT

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.10|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    1,423,241 → 1,424,440

    The protein

    Catalyzed reaction/ biological activity

  • ATP + S-methyl-5-thio-D-ribose --> ADP + H+ + S-methyl-5-thio-α-D-ribose 1-phosphate (according to UniProt)
  • Protein family

  • methylthioribose kinase family (single member, according to UniProt)
  • Modification

  • phosphorylated on Arg-80 OR Arg-82 and Arg-365 [Pubmed|22517742]
  • Structure

  • [PDB|2PUP]
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|E2475C56019C8EA3E05DC8FF89D8FC2751FA2544|mtnK]-[gene|32DD5C61F0F8147DEACBCBBE1283B4E2C88E96E9|mtnA]
    description
    [Pubmed|11545674]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12022921], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([SW|S-box]) [Pubmed|10094622]
  • the [SW|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A783 (ykrT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/783 NBRP B. subtilis, Japan]
  • BKE13560 (Δ[gene|E2475C56019C8EA3E05DC8FF89D8FC2751FA2544|mtnK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACCTCCAATTATGTAA, downstream forward: _UP4_TGATCTATTCATGACCCATT
  • BKK13560 (Δ[gene|E2475C56019C8EA3E05DC8FF89D8FC2751FA2544|mtnK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACCTCCAATTATGTAA, downstream forward: _UP4_TGATCTATTCATGACCCATT
  • References

  • 12022921,10094622,11914366,11545674,15102328,18763711,12787499,18039762,22517742,23649237,15378759,29794222