SubtiBank SubtiBank
tagV
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tagV

phosphotransferase, attaches teichoic acid, teichuronic acid, or acidic capsular polysaccharide to cell wall peptidoglycan via phosphodiester linkage to N-acteylmuramic acid
locus
BSU35520
pI
9.14
mw
43.05 kDa
protein length
391 aa Sequence Blast
gene length
1176 bp Sequence Blast
function
transfer of anionic cell wall polymers from lipid-linked precursors to peptidoglycan
product
phosphotransferase, responsible for attachment of anionic polymers to peptidoglycan
essential
no
synonyms
yvhJ

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.6|Export of anionic polymers and attachment to peptidoglycan]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,647,406 → 3,648,581

    Phenotypes of a mutant

  • a ''[gene|E244A5ABB2FBD4FC3880F0DB700BD935991AE6DD|tagV]'' mutant has no phenoype, the triple ''[gene|68FE85BAA457199D34C9068F38756972CD2D280D|tagT] [gene|62A3CC548E033A45F94FE4386EE29711A6A14C6B|tagU] [gene|E244A5ABB2FBD4FC3880F0DB700BD935991AE6DD|tagV]'' mutant is unable to grow under normal conditions [Pubmed|21964069]
  • The protein

    Protein family

  • LytR-Cps2a-Psr family [Pubmed|19099556]
  • Paralogous protein(s)

  • [protein|62A3CC548E033A45F94FE4386EE29711A6A14C6B|TagU], [protein|68FE85BAA457199D34C9068F38756972CD2D280D|TagT]
  • [SW|Cofactors]

  • Mg2+ [Pubmed|29107701,21964069]
  • Structure

  • [PDB|3NXH]
  • [SW|Localization]

  • cytoplasmic membrane (with extracytoplasmic catalaytic domain) [Pubmed|21964069]
  • Expression and Regulation

    Operons

    genes
    [gene|8F46DEAD6195B566E1A5FDC6E6ED9D29969F4AFA|yvyE]-[gene|E244A5ABB2FBD4FC3880F0DB700BD935991AE6DD|tagV]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A344 (yvhJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/344 NBRP B. subtilis, Japan]
  • BKE35520 (Δ[gene|E244A5ABB2FBD4FC3880F0DB700BD935991AE6DD|tagV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACGCACTCTAACGCGTTCAG, downstream forward: _UP4_TAAAAAATGCCCGGTCCTTT
  • BKK35520 (Δ[gene|E244A5ABB2FBD4FC3880F0DB700BD935991AE6DD|tagV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACGCACTCTAACGCGTTCAG, downstream forward: _UP4_TAAAAAATGCCCGGTCCTTT
  • References

    Reviews

  • 24024634
  • Original publications

  • 14651647,19099556,21964069,22383849,29107701