SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[SW|ABC transporter] (membrane protein) ([protein|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|FtsE]-[protein|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|FtsX]), required for [protein|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|CwlO] activity (cell elongation) and for proper activation of [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A] and initiation of [SW|sporulation]
32.95 kDa
protein length
296 aa Sequence Blast
gene length
891 bp Sequence Blast
control of cell wall synthesis
[SW|ABC transporter] (membrane protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Autolytic activity required for peptidoglycan synthesis (cell elongation)]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Regulatory ABC transporters]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,623,938 → 3,624,828

    Phenotypes of a mutant

  • a ''[gene|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|ftsX]'' mutation is synthetically lethal with a ''[gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]'' mutation (due to a lack of autolysin activity) [Pubmed|23869552,23855774]
  • shorter, fatter cells, this can be rescued by addition of Mg(2+) [Pubmed|23869552,23855774]
  • reduced growth rate, especially at low Mg(2+) concentrations [Pubmed|23869552]
  • loss of genetic competence [pubmed|29553055]
  • The protein

    Catalyzed reaction/ biological activity

  • necessary for the autolysin activity of [protein|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|CwlO] [Pubmed|23855774]
  • Protein family

  • [SW|ABC-4 integral membrane protein family] (according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|23869552]
  • Expression and Regulation


    (according to [ DBTBS]) null

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials


  • GP3198 ([gene|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|ftsX]::''spc''), available in [SW|Jörg Stülke]'s lab
  • BKE35250 (Δ[gene|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|ftsX]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCACGCAAGTGGCGCCCGA, downstream forward: _UP4_TAAAGTGAAAAAGCCGTTCC
  • BKK35250 (Δ[gene|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|ftsX]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTCACGCAAGTGGCGCCCGA, downstream forward: _UP4_TAAAGTGAAAAAGCCGTTCC
  • References

  • 10092453,18573177,23651456,14651647,18763711,23855774,23869552,29553055,31437162