SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to adenine desaminase
66.47 kDa
protein length
580 aa Sequence Blast
gene length
1743 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    713,664 → 715,406

    The protein

    Catalyzed reaction/ biological activity

  • adenine + H+ + H2O --> hypoxanthine + NH4+ (according to UniProt)
  • Protein family

  • [SW|Metallo-dependent hydrolases superfamily] (according to UniProt)
  • Modification

  • phosphorylation on Ser-399 [Pubmed|17218307]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A910 (yerA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE06560 (Δ[gene|E20A5429BCD8719A403229AFB200225EA14EE2DB|yerA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACATACTCTCCTTTA, downstream forward: _UP4_TAAAATATAAAAGAGCAGGG
  • BKK06560 (Δ[gene|E20A5429BCD8719A403229AFB200225EA14EE2DB|yerA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACATACTCTCCTTTA, downstream forward: _UP4_TAAAATATAAAAGAGCAGGG
  • References

  • 17218307