SubtiBank SubtiBank
yerA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yerA

similar to adenine desaminase
locus
BSU06560
pI
5.82
mw
66.47 kDa
protein length
580 aa Sequence Blast
gene length
1743 bp Sequence Blast
function
unknown
product
unknown
essential
no
ec
3.5.4.2
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    713,664 → 715,406

    The protein

    Catalyzed reaction/ biological activity

  • Adenine + H2O = hypoxanthine + NH3 (according to Swiss-Prot)
  • Protein family

  • [SW|Metallo-dependent hydrolases superfamily] (according to UniProt)
  • Modification

  • phosphorylation on Ser-399 [Pubmed|17218307]
  • Expression and Regulation

    Operons

    genes
    [gene|E20A5429BCD8719A403229AFB200225EA14EE2DB|yerA]-[gene|BE1F7BA77CE8B6A1A2D22F31421C27F2E954816A|yerB]-[gene|B948BD67148DC53B371E6748347982067CE28C36|yerC]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A910 (yerA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/910 NBRP B. subtilis, Japan]
  • BKE06560 (Δ[gene|E20A5429BCD8719A403229AFB200225EA14EE2DB|yerA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACATACTCTCCTTTA, downstream forward: _UP4_TAAAATATAAAAGAGCAGGG
  • BKK06560 (Δ[gene|E20A5429BCD8719A403229AFB200225EA14EE2DB|yerA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACATACTCTCCTTTA, downstream forward: _UP4_TAAAATATAAAAGAGCAGGG
  • References

  • 17218307