SubtiBank SubtiBank
ybxI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybxI

beta-lactamase
locus
BSU_02090
pI
6.84
mw
30.49 kDa
protein length
267 aa Sequence Blast
gene length
804 bp Sequence Blast
function
unknown
product
beta-lactamase
essential
no
ec
3.5.2.6
synonyms
ybdS

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    228,549 → 229,352

    The protein

    Catalyzed reaction/ biological activity

  • β-lactam + H2O --> substituted β-amino acid (according to UniProt)
  • Protein family

  • [SW|beta-lactamase family] (according to UniProt)
  • class-D beta-lactamase family (single member, according to UniProt)
  • Structure

  • [PDB|5E2F]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|E1CBB22683967FA47CB5886755BC3C3BFE6CC499|ybxI]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B962 (ybxI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1961 NBRP B. subtilis, Japan]
  • BKE02090 (Δ[gene|E1CBB22683967FA47CB5886755BC3C3BFE6CC499|ybxI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTTCTCCCCTTCGT, downstream forward: _UP4_TAAATAAAAGAGCCCTGCAC
  • BKK02090 (Δ[gene|E1CBB22683967FA47CB5886755BC3C3BFE6CC499|ybxI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTTCTCCCCTTCGT, downstream forward: _UP4_TAAATAAAAGAGCCCTGCAC
  • References

  • 18957862,26551395