SubtiBank SubtiBank
cshA [2018-01-11 09:09:26]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cshA [2018-01-11 09:09:26]

DEAD-box RNA helicase, important for adaptation to low temperatures
locus
BSU04580
pI
9.89
mw
57.11 kDa
protein length
511 aa Sequence Blast
gene length
1533 bp Sequence Blast
function
RNA helicase
product
DEAD-box RNA helicase
essential
no
synonyms
ydbR

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.3|DEAD-box RNA helicases]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.6|Ribosome assembly]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.5|Cold stress proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    511,106 → 512,641

    Phenotypes of a mutant

  • poor growth at low temperatures (16 to 20°C) [Pubmed|23175651]
  • reduced number of [SW|ribosome]s [Pubmed|23175651]
  • no expression of the ''[gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]-[gene|9E3FF9D0B33D7EFEA3B61FF863BB46CC6DFD4F9B|frlO]-[gene|8256CAAEC591E40A8CB172FF053E03BFFD5A4B54|frlN]-[gene|1F245030D0C81DC96FC0642199CA00579CF46D06|frlM]-[gene|C3823AFED3E5C3D1EA04C38D861239468C9E6349|frlD]'' operon [Pubmed|23175651]
  • strongly increased expression of the ''[gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]-[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB]'' operon [Pubmed|23175651]
  • transcription profile resulting from ''[gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|rny]'' depletion: [http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE36877 GEO] [Pubmed|23175651]
  • The protein

    Catalyzed reaction/ biological activity

  • RNA helicase
  • required for [SW|ribosome] assembly (biogenesis of the large subunit) [Pubmed|23175651]
  • unwind duplex RNA with or without overhangs [pubmed|28238534]
  • Protein family

  • helicase C-terminal domain (according to Swiss-Prot) [SW|DEAD-box RNA helicases]
  • Paralogous protein(s)

  • [protein|C83BD80DE0FD187D07B914F64696438ED5130107|CshB], [protein|EACD0C84AA3CE41EF05EAA3D25AA1153293EB562|DeaD], [protein|0362D937D985846AEE4D0DEA57B62F915E8D35E5|YfmL]
  • Structure

  • [PDB|5IVL] [Pubmed|28238534]
  • [SW|Localization]

  • cytoplasma, colocalizes with the ribosomes [Pubmed|16352840,27708634], cell membrane [Pubmed|20572937]
  • Expression and Regulation

    Operons

    genes
    [gene|E169F9711635457EA65FA71CCE9D7FF29DD8DF02|cshA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • GP1035 (Δ[gene|E169F9711635457EA65FA71CCE9D7FF29DD8DF02|cshA]::aphA3), available in [SW|Jörg Stülke]'s lab
  • GP1083 (Δ[gene|E169F9711635457EA65FA71CCE9D7FF29DD8DF02|cshA]::cat), available in [SW|Jörg Stülke]'s lab
  • BKE04580 (Δ[gene|E169F9711635457EA65FA71CCE9D7FF29DD8DF02|cshA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTATAAAACTGCCCTTT, downstream forward: _UP4_TAATTTGATCGATTCAGAGC
  • BKK04580 (Δ[gene|E169F9711635457EA65FA71CCE9D7FF29DD8DF02|cshA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTATAAAACTGCCCTTT, downstream forward: _UP4_TAATTTGATCGATTCAGAGC
  • Expression vector

  • for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [SW|SPINE], in [SW|pGP382]: pGP1387, available in [SW|Jörg Stülke]'s lab
  • for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [SW|SPINE], expression from the native chromomsomal site: GP1026 (aphA3), available in [SW|Jörg Stülke]'s lab
  • for expression/ purification from ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP1386, available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • pGP1369 for chromosomal expression of CshA-YFP, available in [SW|Jörg Stülke]'s lab
  • ''B. subtilis'' GP1081 cshA-gfp spc, available in [SW|Jörg Stülke]'s lab,
  • GP1721 (in [SW|pBP43]), expression of '' cshA-GFP''::''spc'' under the native promoter, available in [SW|Jörg Stülke]'s lab [Pubmed|27708634]
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1010 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • GP1074 (tet), available in [SW|Jörg Stülke]'s lab
  • Labs working on this gene/protein

  • [SW|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]
  • References

    Reviews

  • 22568516,29314657
  • Original publications

  • 20572937,23175651,21803996,16352840,27708634,27965645,28238534