The second international online conference
#Subtillery2021 will be held 14th - 18th June - save the date, for more information see the
conference website!
The 21st
International Conference on Bacilli has been postponed to 2022 and will take place in Prague.
aconitase, trigger enzyme
product
aconitase, trigger enzyme
Genomic Context
categories
[category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.4|TCA cycle][category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.9|Utilization of branched-chain amino acids][category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.4|Trigger enzyme that acts by binding of a specific RNA element][category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.4|RNA binding regulators]Gene
Coordinates
1,926,680 → 1,929,409
Phenotypes of a mutant
glutamate auxotrophy and a defect in sporulation [Pubmed|9393699]The protein
Catalyzed reaction/ biological activity
Citrate <=> isocitrateBinding to iron responsive elements (IRE RNA) in the absence of the FeS cluster [Pubmed|23354745,10468622]2-methylaconitate --> 2-methyl-isocitrate in the methylcitric acid cycle [pubmed|28956599][SW|Cofactors]
FeS clusterStructure
[PDB|1L5J] (''E. coli'') [pubmed|11992126]Additional information
''B. subtilis'' aconitase is both an enzyme and an RNA binding protein ([SW|moonlighting protein]) [Pubmed|10468622]extensive information on the structure and enzymatic properties of CitB can be found at [http://www.proteopedia.org/wiki/index.php/Aconitase Proteopedia]belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]Expression and Regulation
Operons
genes
[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]-[gene|50BBC8AB77B99B9FE5B8A8FE906D39DFEA4ED652|yneN]
description
[Pubmed|22383849]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1310745], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12591885], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon][protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC]: repression, (molecular inducer: citrate) [pubmed|10656796] [pubmed|12100558], in [regulon|FE15A41A58A8177280817CA3825764C39185021A|CcpC regulon][protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12100558], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]regulation
expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|12591885], indirect negative regulation by [protein|search|AbrB] [Pubmed|20817675]view in new tabOther regulations
[protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]: translation repression, [Pubmed|18697947]Biological materials
Mutant
GP1275 (Δ''citB''::''erm''), available in [SW|Jörg Stülke]'s labGP1441 (ΔcitB::spc), available in [SW|Jörg Stülke]'s lab1A999 (''citB''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A999&Search=1A999 BGSC]GP2338 (Δ''[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]''::''kan''), Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s labGP2339 (Δ''[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]''::''lox72''), Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s labBKE18000 (Δ[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCAAAATCCCCCTT, downstream forward: _UP4_TGATGAATCAATAGGAAGAGBKK18000 (Δ[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCAAAATCCCCCTT, downstream forward: _UP4_TGATGAATCAATAGGAAGAGlacZ fusion
pGP700 (in [protein|search|pAC5]), available in [SW|Jörg Stülke]'s labGFP fusion
GP1434 (spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s labtwo-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s labFLAG-tag construct
GP1144 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s labGP1145 (kan), available in [SW|Jörg Stülke]'s labAntibody
available in [SW|Linc Sonenshein]'s labLabs working on this gene/protein
[SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage][SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]References
Reviews
12732309,2696478,18261896,18086213 Original publications
18697947,20097860,2118511,12850135,2413006,10656796,10468622,6143742,16395550,16923907,9642180,9393699,12591885,2105305,20933603,21099137,21446632,21821766,22389480,23139400,23354745,20817675,15378759,16923908,21744456,11992126,28956599