SubtiBank SubtiBank
citB [2019-02-04 15:07:49]
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

citB [2019-02-04 15:07:49]

aconitase, trigger enzyme
99.14 kDa
protein length
909 aa Sequence Blast
gene length
2730 bp Sequence Blast
TCA cycle
aconitase, trigger enzyme

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|TCA cycle]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of branched-chain amino acids]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW|Trigger enzyme that acts by binding of a specific RNA element]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.4|RNA binding regulators]
  • Gene

    1,926,680 → 1,929,409

    Phenotypes of a mutant

  • glutamate auxotrophy and a defect in sporulation [Pubmed|9393699]
  • The protein

    Catalyzed reaction/ biological activity

  • Citrate <=> isocitrate
  • Binding to iron responsive elements (IRE RNA) in the absence of the FeS cluster [Pubmed|23354745,10468622]
  • 2-methylaconitate --> 2-methyl-isocitrate in the methylcitric acid cycle [pubmed|28956599]
  • [SW|Cofactors]

  • FeS cluster [pubmed|29292548]
  • Structure

  • [PDB|2B3X] (the human enzyme, 53% identity) [pubmed|16407072]
  • Additional information

  • ''B. subtilis'' aconitase is both an enzyme and an RNA binding protein ([SW|moonlighting protein]) [Pubmed|10468622]
  • extensive information on the structure and enzymatic properties of CitB can be found at [ Proteopedia]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1310745], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12591885], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC]: repression, (molecular inducer: citrate) [pubmed|10656796] [pubmed|12100558], in [regulon|FE15A41A58A8177280817CA3825764C39185021A|CcpC regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12100558], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|12591885], indirect negative regulation by [protein|search|AbrB] [Pubmed|20817675]
  • view in new tab

    Other regulations

  • [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]: translation repression, [Pubmed|18697947]
  • Biological materials


  • GP1275 (Δ''citB''::''erm''), available in [SW|Jörg Stülke]'s lab
  • GP1441 (ΔcitB::spc), available in [SW|Jörg Stülke]'s lab
  • 1A999 (''citB''::''spec''), [Pubmed| ], available at [ BGSC]
  • GP2338 (Δ''[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]''::''kan''), Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • GP2339 (Δ''[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]''::''lox72''), Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • BKE18000 (Δ[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCAAAATCCCCCTT, downstream forward: _UP4_TGATGAATCAATAGGAAGAG
  • BKK18000 (Δ[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCAAAATCCCCCTT, downstream forward: _UP4_TGATGAATCAATAGGAAGAG
  • lacZ fusion

  • pGP700 (in [protein|search|pAC5]), available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • GP1434 (spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1144 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • GP1145 (kan), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Linc Sonenshein]'s lab
  • labs

  • [SW|Linc Sonenshein], Tufts University, Boston, MA, USA [ Homepage]
  • [SW|Jörg Stülke], University of Göttingen, Germany [ Homepage]
  • References


  • 12732309,2696478,18261896,18086213
  • Original publications

  • 18697947,20097860,2118511,12850135,2413006,10656796,10468622,6143742,16395550,16923907,9642180,9393699,12591885,2105305,20933603,21099137,21446632,21821766,22389480,23139400,23354745,20817675,15378759,16923908,21744456,11992126,28956599,16407072